Promoters/Catalog/Cell signalling
These promoters are all related to cell signalling. Cell signalling is often mediated by a small molecule or peptide that diffuses between cells and can diffuse through cell membranes. The signalling molecule is recognized by a receptor protein (often located in or near the membrane of the cell) that regulates the activity of the promoters listed here directly, or via a signalling cascade.
| Name | Description | Promoter Sequence | Positive Regulators | Negative Regulators | Length | Doc | Status |
|---|---|---|---|---|---|---|---|
| BBa_I1051 | Lux cassette right promoter | . . . tgttatagtcgaatacctctggcggtgata | 68 | 1735 | In stock | ||
| BBa_I14015 | P(Las) TetO | . . . ttttggtacactccctatcagtgatagaga | 170 | 1524 | In stock | ||
| BBa_I14016 | P(Las) CIO | . . . ctttttggtacactacctctggcggtgata | 168 | 1523 | In stock | ||
| BBa_I14017 | P(Rhl) | . . . tacgcaagaaaatggtttgttatagtcgaa | 51 | 13707 | In stock | ||
| BBa_I739105 | Double Promoter (LuxR/HSL, positive / cI, negative) | . . . cgtgcgtgttgataacaccgtgcgtgttga | 99 | 3259 | Not in stock | ||
| BBa_I746104 | P2 promoter in agr operon from S. aureus | . . . agattgtactaaatcgtataatgacagtga | 96 | 1753 | In stock | ||
| BBa_I751501 | plux-cI hybrid promoter | . . . gtgttgatgcttttatcaccgccagtggta | 66 | 1222 | Not in stock | ||
| BBa_I751502 | plux-lac hybrid promoter | . . . agtgtgtggaattgtgagcggataacaatt | 74 | 4200 | Not in stock | ||
| BBa_I761011 | CinR, CinL and glucose controlled promotor | . . . acatcttaaaagttttagtatcatattcgt | 295 | 2080 | It's complicated | ||
| BBa_J06403 | RhIR promoter repressible by CI | . . . tacgcaagaaaatggtttgttatagtcgaa | 51 | 1464 | In stock | ||
| BBa_J102001 | Reverse Lux Promoter | . . . tcttgcgtaaacctgtacgatcctacaggt | 55 | 1785 | It's complicated | ||
| BBa_J64000 | rhlI promoter | . . . atcctcctttagtcttccccctcatgtgtg | 72 | 1470 | Not in stock | ||
| BBa_J64010 | lasI promoter | . . . taaaattatgaaatttgcataaattcttca | 53 | 3970 | Not in stock | ||
| BBa_J64067 | LuxR+3OC6HSL independent R0065 | . . . gtgttgactattttacctctggcggtgata | 98 | 1810 | Not in stock | ||
| BBa_J64712 | LasR/LasI Inducible & RHLR/RHLI repressible Promoter | . . . gaaatctggcagtttttggtacacgaaagc | 157 | 1866 | Not in stock | ||
| BBa_K091107 | pLux/cI Hybrid Promoter | . . . acaccgtgcgtgttgatatagtcgaataaa | 57 | 4524 | It's complicated | ||
| BBa_K091117 | pLas promoter | . . . aaaattatgaaatttgtataaattcttcag | 126 | 3108 | It's complicated | ||
| BBa_K091143 | pLas/cI Hybrid Promoter | . . . ggttctttttggtacctctggcggtgataa | 164 | 1530 | It's complicated | ||
| BBa_K091146 | pLas/Lux Hybrid Promoter | . . . tgtaggatcgtacaggtataaattcttcag | 126 | 4661 | In stock | ||
| BBa_K091156 | pLux | . . . caagaaaatggtttgttatagtcgaataaa | 55 | 1608 | Not in stock | ||
| BBa_K091157 | pLux/Las Hybrid Promoter | . . . ctatctcatttgctagtatagtcgaataaa | 55 | 2254 | Not in stock | ||
| BBa_K145150 | Hybrid promoter: HSL-LuxR activated, P22 C2 repressed | . . . tagtttataatttaagtgttctttaatttc | 66 | 2130 | It's complicated | ||
| BBa_K1520010 | Prlux-rbs-rfp-Ter | . . . caccttcgggtgggcctttctgcgtttata | 932 | 1622 | It's complicated | ||
| BBa_K1520515 | MC7-rbs-luxI-Ter-Pcons2-rbs-luxR-Ter-Prlux-rbs-OMPA-golB-rbs-luxI-Ter. | . . . caccttcgggtgggcctttctgcgtttata | 3611 | 1361 | Not in stock | ||
| BBa_K1520516 | MC31-rbs-luxI-Ter-Pcons2-rbs-luxR-Ter-Prlux-rbs-OMPA-golB-rbs-luxI-Ter | . . . caccttcgggtgggcctttctgcgtttata | 3610 | 1362 | Not in stock | ||
| BBa_K2558001 | lux pR-HS | . . . caagaaaatggtttgttactttcgaataaa | 55 | 15965 | It's complicated | ||
| BBa_K266000 | PAI+LasR -> LuxI (AI) | . . . caccttcgggtgggcctttctgcgtttata | 963 | 2325 | It's complicated | ||
| BBa_K266005 | PAI+LasR -> LasI & AI+LuxR --| LasI | . . . aataactctgatagtgctagtgtagatctc | 819 | 1498 | It's complicated | ||
| BBa_K266006 | PAI+LasR -> LasI+GFP & AI+LuxR --| LasI+GFP | . . . caccttcgggtgggcctttctgcgtttata | 1705 | 1471 | It's complicated | ||
| BBa_K266007 | Complex QS -> LuxI & LasI circuit | . . . caccttcgggtgggcctttctgcgtttata | 2676 | 1513 | It's complicated | ||
| BBa_K3205003 | luxPR_3A | . . . caagaaaatggtttgttatagtcgaataaa | 55 | 11136 | Not in stock | ||
| BBa_K3205004 | luxPR_3G | . . . caagaaaatggtttgttatagtcgaataaa | 55 | 11193 | Not in stock | ||
| BBa_K3205005 | luxPR_4G12T | . . . caagaaaatggtttgttatagtcgaataaa | 55 | 11309 | Not in stock | ||
| BBa_K658006 | position 3 mutated promoter lux pR-3 (luxR & HSL regulated) | . . . caagaaaatggtttgttatagtcgaataaa | 55 | 3218 | Not in stock | ||
| BBa_K658007 | position 5 mutated promoter lux pR-5 (luxR & HSL regulated) | . . . caagaaaatggtttgttatagtcgaataaa | 55 | 3170 | Not in stock | ||
| BBa_K658008 | position 3&5 mutated promoter lux pR-3/5 (luxR & HSL regulated) | . . . caagaaaatggtttgttatagtcgaataaa | 55 | 3301 | Not in stock | ||
| BBa_R0062 | Promoter (luxR & HSL regulated -- lux pR) | . . . caagaaaatggtttgttatagtcgaataaa | 55 | 77850 | In stock | ||
| BBa_R0063 | Promoter (luxR & HSL regulated -- lux pL) | . . . cacgcaaaacttgcgacaaacaataggtaa | 151 | 4614 | In stock | ||
| BBa_R0071 | Promoter (RhlR & C4-HSL regulated) | . . . gttagctttcgaattggctaaaaagtgttc | 53 | 9591 | In stock | ||
| BBa_R0078 | Promoter (cinR and HSL regulated) | . . . ccattctgctttccacgaacttgaaaacgc | 225 | 2460 | In stock | ||
| BBa_R0079 | Promoter (LasR & PAI regulated) | . . . ggccgcgggttctttttggtacacgaaagc | 157 | 18233 | In stock | ||
| BBa_R1062 | Promoter, Standard (luxR and HSL regulated -- lux pR) | . . . aagaaaatggtttgttgatactcgaataaa | 56 | 2617 | In stock |