DNA/Recombination

< Back to DNA parts

Salmonella typhimurium-derived Hin/hix DNA recombination system

Karmella Haynes and the [http://parts.mit.edu/wiki/index.php/Davidson_2006 2006 Davidson College/Missouri Western iGEM team], designed and constructed a set of parts from the Salmonella typhimurium-derived DNA recombination system. You can read more about the 2006 Davidson/Missouri Western project in their open-access paper [http://www.jbioleng.org/content/2/1/8 Engineering bacteria to solve the Burnt Pancake Problem] published in the Journal of Biological Engineering Haynes. The following is excerpted from their paper.

In Salmonella, Hin DNA recombinase (BBa_J31000, BBa_J31001) catalyzes an inversion reaction that regulates the expression of alternative flagellin genes by switching the orientation of a promoter located on a 1 kb invertible DNA segment Zieg,Zieg80. Two palindromic 26 bp hix sequences flank the invertible DNA segment and serve as the recognition sites for cleavage and strand exchange. A ~70 bp cis-acting recombinational enhancer (RE) increases efficiency of protein-DNA complex formation (BBa_J3101) Johnson. We have reconstituted the genetic elements required for DNA inversion as a collection of modular genetic elements for use in E. coli. Our system is a proof-of-concept genetic computing device that manipulates plasmid DNA processors within living cells.

In Salmonella, the asymmetrical palindromic sequences hixL and hixR flank the invertible DNA segment and serve as the recognition sites for cleavage and strand exchange. Our system uses hixC (BBa_J44000), a composite symmetrical hix site that shows higher binding affinity for Hin and a 16-fold slower inversion rate than wild type sites hixL and hixR Lim,Moskowitz.

We have demonstrated that a modified Hin/hix DNA recombination system can be used in vivo to manipulate at least two adjacent hixC-flanked DNA segments; HinLVA and hixC are sufficient for DNA inversion activity. The Hin/hix DNA recombination system could be used for other biological engineering applications. We have developed a set of modular genetic elements, hixC (BBa_J44000), RE (BBa_J3101), and HinLVA (BBa_J31001), that expands the repertoire of molecular tools for enzyme-mediated DNA manipulation in vivo.

More...

Name	Description	Sequence	Recombinase	Length
BBa_J3101	Recombinational Enhancer (RE) for Hin/Hix inverting	. . . ctttctagtgcaaattgtgaccgcattttg		77
BBa_J44000	hixC binding site for Salmonella typhimurium Hin recombinase	ttatcaaaaaccatggtttttgataa		26

References

<biblio>

1. Zieg pmid=322276
2. Zieg80 pmid=6933466
3. Johnson pmid=2548848
4. Haykinson pmid=8508775
5. PerkinsBalding pmid=9244261
6. Haynes pmid=18492232
7. Ham pmid=18665232
8. Nanassy pmid=9691026
9. Moswitz pmid=1885005
10. Lim pmid=1597453

</biblio>

Bacteriophage P1 Cre/lox DNA recombination system

Chris Anderson, a professor of bioengineering at UC Berkeley, constructed the lox recombination site BBa_J61046.

Eimad Shotar, a member of the [http://parts.mit.edu/igem07/index.php/Paris 2007 Paris iGEM team], constructed the lox recombination sites BBa_I718016 and BBa_I718017.

The following text is excerpted from Siegel et al. Siegel04.

Bacteriophage P1 uses a site-specific recombination system that is responsible for partitioning newly synthesized genomic copies during replication Abremski, Hoess. This system is composed of a 38-kD phage-encoded Cre recombinase that mediates symmetrical recombination between two 34-bp loxP sites Abremski, which are recreated after recombination. Recombination between two compatible loxP sites will excise or invert the intervening DNA in the case of an intramolecular reaction or transfer suitably flanked loxP DNA in an intermolecular double cross-over recombination event. The Cre/loxP system does not require accessory factors to carry out recombination in vivo or in vitro, and studies have identified several hetero-specific loxP sequences that exclusively recombine with themselves, but not with wild-type lox Hoess86, Sauer92, Lee98, Siegel01. Importantly, the Cre/lox system has also been shown to be functional in site-specific recombination in mammalian cell lines Sauer88.

More...

Name	Description	Sequence	Recombinase	Length
BBa_I718016	lox66	. . . cttggtatagcatacattatacgaacggta		34
BBa_I718017	lox71	. . . gttcgtatacgatacattatacgaagttat		34
BBa_J61046	[Lox] site for recombination	. . . cttcgtataatgtatgctatacgaagttat		34
BBa_K1680005	loxP Site	. . . cttcgtatagcatacattatacgaagttat		34
BBa_K315011	Variant reverse lox N	. . . cttcgtatagtataccttatacgaagttat		34
BBa_K416002	36 Base Pair LoxP	. . . tcgtataatgtatgctatacgaagttatcg		36
BBa_K886000	Fixed lox71	. . . gttcgtatagcatacattatacgaagttat		34

References

<biblio>

1. Abremski pmid=6319400
2. Hoess pmid=6230671
3. Hamilton pmid=6333513
4. Hoess86 pmid=3457367
5. Sauer88 pmid=2839833
6. Sauer92 pmid=1554399
7. Lee98 pmid=9714735
8. Sauer98 pmid=9608509
9. Siegel01 pmid=11576551
10. Sauer02 pmid=12624421
11. Siegel04 pmid=15173117

</biblio>

Bacteriophage λ /att DNA recombination system

The following is excerpted from Radman-Livaja et al. RadmanLivaja and Landy et al. Landy. It has been edited for clarity.

Bacteriophage λ has long served as a model system for studies of regulated site-specific recombination. In conditions favorable for bacterial growth, the phage genome is inserted into the Escherichia coli genome by an ‘integrative’ recombination reaction, which takes place between DNA attachment sites called attP and attB in the phage and bacterial genomes, respectively. As a result, the integrated λ DNA is bounded by hybrid attachment sites, termed attL and attR. In response to the physiological state of the bacterial host or to DNA damage, λ phage DNA excises itself from the host chromosome. This excision reaction recombines attL with attR to precisely restore the attP and attB sites on the circular λ and E. coli DNAs Campbell. The product of the phage gene int is required for both integration and excision of the λ prophage Zissler67.

The phage-encoded λ integrase protein (Int) splices together bacterial and phage attachment sites by a mechanism that is common to a large family of tyrosine recombinases with diverse biological functions (for reviews, see Hallett97, Azaro02). Recombination initiates with the pairing of two specific DNA segments by a tetramer of recombinase molecules. A four-way DNA junction (Holliday junction) is formed by the cleavage, exchange and ligation of one pair of strands, and is resolved to helical DNA products by the exchange of the second pair of strands [4–7]. The DNA cleavage activity is strictly regulated within the tetramer, with only one pair of molecules active at a time. This control ensures the ordered pairwise exchange of DNA strands and avoids potentially harmful double-strand breaks.

λ recombination has a strong directional bias in response to environmental conditions. Accessory factors, whose expression levels change in response to host physiology, control the action of Int and determine whether the phage genome will remain integrated or be excised. Int has two DNA-binding domains: a C-terminal domain, consisting of a catalytic domain and a core-binding (CB) domain, that interacts with the core recombining sites and an N-terminal domain (N-domain) that recognizes the regulatory arm DNA sites Wojciak02. The heterobivalent Int molecules bridge distant core and arm sites with the help of accessory proteins, such as integration host factor (IHF), which bend the DNA at intervening sites, and appose arm and core sequences for interaction with the Int recombinase. Five arm DNA sites in the regions flanking the core of attP are differentially occupied during integration and excision reactions. The integration products attL and attR cannot revert back to attP and attB without assistance from the phage-encoded factor Xis, which bends DNA on its own or in combination with the host-encoded factor Fis Abremski82,Abremski81,Hoess80,Thompson87a,Thompson87b,Ball91. Xis also inhibits integration, and prevents the attP and attB products of excision from reverting to attL and attR Abremski81,18]. Excision is inhibited by high concentrations of IHF <cite>Bushman85,Thompson86. Because the cellular levels of IHF and Fis proteins respond to growth conditions, these host-encoded factors have been proposed as the master signals for integration and excision Thompson87a,Bushman85,Thompson86,-23.

The following is excerpted from Landy et al. Landy. It has been edited for clarity.

The phage (attP) and bacterial (attB) att sites are designated POP’ and BOB’, respectively, and the prophage att sites are designated BOP’ (attL) and POB’ (attR). Transducing phage carrying attL (λgal) or attR (λbio) are generated from a prophage which has excised from the host chromosome by a rare int-independent recombination which deletes phage DNA from one end of the prophage and adds bacterial DNA to the other Campbell. A phage carrying the bacterial att site, BOB’, is obtained as a product of int-promoted recombination between a gal (BOP’) and a bio (POB’) transducing phage which is capable of transducing gal and bio together Echols70.

When Escherichia coli carries a deletion of the primary bacterial att site BOB’, int-dependent integration of λ can be detected at numerous loci (secondary bacterial att sites) on the E. coli chromosome Shimada72. This integration always involves the phage att site (POP’) Shimada75 and is thus very similar to the behavior of IS-elements Fiandt72, Hirsch72. The secondary prophage att sites are given the general designation ΔOP’ and POΔ’ and they differ from BOP’ and POB’ and from each other in their biological properties as determined by int- and xis -dependent recombination frequencies with various att sites.

References

<biblio>

1. Campbell Campbell, AM. Episomes. In: Caspari EW, Thoday JM. , editors. Advances in Genetics. 1. New York: Academic Press; 1962. pp. 101–145.
2. Zissler67 pmid=5637199
3. Guameros70 pmid=4907272
4. Kaiser70 pmid=4907271
5. Echols70 pmid=4907273
6. Shimada72 pmid=4552408
7. Shimada75 pmid=1095763
8. Fiandt72 pmid=4567155
9. Hirsch72 pmid=4567154
10. Hoess80 pmid=6446713
11. Abremski81 pmid=6279866
12. Abremski82 pmid=6213611
13. Bushman85 pmid=2932798
14. Thompson86 pmid=2946666
15. Thompson87a pmid=2957063
16. Thompson87b pmid=2958633
17. Ball91 pmid=1829453
18. Hallett97 pmid=9348666
19. Azaro02 Azaro, MA; Landy, A. λ Int and the λ Int family. In: Craig NL, Craigie R, Gellert M, Lambowitz A. , editors. Mobile DNA II. Washington, DC: ASM Press; 2002. pp. 118–148.
20. Wojciak02 pmid=11904406
21. Landy pmid=331474
22. Landy89 pmid=2528323
23. RadmanLivaja pmid=16368232

</biblio>

E. coli XerCD/dif DNA recombination system

Xiaonan Wang, a member of the [http://parts.mit.edu/igem07/index.php/Edinburgh 2007 University of Edinburgh iGEM team], designed the dif recombination sites BBa_I742101 and BBa_I742102.

The following text is excerpted from Ip et al. Ip03.

The separation and segregation of newly replicated [E. coli] circular chromosomes can also be prevented by the formation of circular chromosome dimers, which can arise during crossing over by homologous recombination Blakely91; Clerget91; Kuempel91. In E. coli, these dimers, which arise about once every six generations, are resolved to monomers by the action of the FtsK–XerCD–dif chromosome dimer resolution machinery Steiner98a, Steiner98b, Recchia99, Steiner99. Two site-specific recombinases of the tyrosine recombinase family, XerCD, act at a 28 bp recombination site, dif, located in the replication terminus region of the E. coli chromosome to remove the crossover introduced by dimer formation, thereby converting dimers to monomers. A complete dimer resolution reaction during recombination at dif requires the action of the C-terminal domain of FtsK (FtsK_C) Steiner99; Barre00. FtsK is a multifunctional protein whose N-terminal domain acts in cell division, while the C-terminal domain functions in chromosome segregation Liu98; Wang98; Yu98a, Yu98b. Therefore, FtsK is well suited to coordinate chromosome segregation and cell division. A purified protein, FtsK_50C, containing a functional C-terminal domain, can translocate DNA in an ATP-dependent manner and activate Xer recombination at the recombination site dif, thereby reconstituting in vitro the expected in vivo activities of the C-terminal domain of the complete FtsK protein Aussel02.

More...

Name	Description	Sequence	Recombinase	Length
BBa_I742101	dif site with forward orientation	. . . tcggtgcgcataatgtatattatgttaaat		31
BBa_I742102	dif site with reverse orientation	. . . tcatttaacataatatacattatgcgcacc		31

References

<biblio>

1. Blakely91 pmid=1931824
2. Clerget91 pmid=1931823
3. Kuempel91 pmid=1657123
4. Steiner98a pmid=9484882
5. Steiner98b pmid=9829936
6. Liu98 pmid=9723927
7. Wang98 pmid=9723913
8. Yu98a pmid=9495771
9. Yu98b pmid=9829960
10. Steiner99 pmid=10027974
11. Recchia99 pmid=10523315
12. Barre00 pmid=11114887
13. Aussel02 pmid=11832210
14. Ip03 pmid=14633998

</biblio>

Other DNA recombination sites

More...

Name	Description	Sequence	Length
BBa_I11022	Lambda attB, reverse complement	accactttgtacaagaaagctgggt	25
BBa_I11023	Lambda attP	. . . tcactatcagtcaaaataaaatcattattt	232
BBa_I11032	P22 ''attB'', reverse complement	acgaccttcgcattacgaatgcgctgc	27
BBa_I11033	P22 ''attP''	. . . gggacatatttgggacagaagtaccaaaaa	260
BBa_I718016	lox66	. . . cttggtatagcatacattatacgaacggta	34
BBa_I718017	lox71	. . . gttcgtatacgatacattatacgaagttat	34
BBa_I742101	dif site with forward orientation	. . . tcggtgcgcataatgtatattatgttaaat	31
BBa_I742102	dif site with reverse orientation	. . . tcatttaacataatatacattatgcgcacc	31
BBa_J3101	Recombinational Enhancer (RE) for Hin/Hix inverting	. . . ctttctagtgcaaattgtgaccgcattttg	77
BBa_J44000	hixC binding site for Salmonella typhimurium Hin recombinase	ttatcaaaaaccatggtttttgataa	26
BBa_J61020	[FRT]	. . . ttcctatactttttagagaataggaacttc	34
BBa_J61046	[Lox] site for recombination	. . . cttcgtataatgtatgctatacgaagttat	34
BBa_J72001	{FRT} recombination site for flp recombinase in BBb	. . . ttcctatactttctagagaataggaacttc	36
BBa_K112141	attR2 recombination site	. . . gttcagctttcttgtacaaagtggttgatc	136
BBa_K112142	attR2 recombination site-reverse orientation	. . . aacacaacatatccagtcactatggtcgac	136
BBa_K137008	fimE IRR	. . . gaaacatttggggccaaactgtccatatta	35
BBa_K137010	fimE IRL	. . . gagtcaaaatggccccaattgtcttgtatt	35
BBa_K1680005	loxP Site	. . . cttcgtatagcatacattatacgaagttat	34
BBa_K315011	Variant reverse lox N	. . . cttcgtatagtataccttatacgaagttat	34
BBa_K3697003	Homology Arms for KanR integration in B. Subtilis	. . . gcttgcaaacaaaaaaaccaccgctaccag	1103
BBa_K416002	36 Base Pair LoxP	. . . tcgtataatgtatgctatacgaagttatcg	36
BBa_K5276011	TP901B-TC	. . . atcaaggtaaatgctttttgctttttttgc	53
BBa_K5276012	TP901P-TC	. . . ttaattgaaataaacgaaataaaaactcgc	50
BBa_K863201	3' UTR site of alcohol oxidase 1 gene (aox1)	. . . tcatcaacttgaggggcactatcttgtttt	676
BBa_K886000	Fixed lox71	. . . gttcgtatagcatacattatacgaagttat	34