Coding

Part:BBa_K1319004

Designed by: Florian Gohr, Michael Osthege   Group: iGEM14_Aachen   (2014-09-25)
Revision as of 07:11, 13 October 2019 by Yuruim (Talk | contribs) (Cloning)

TEV protease with anti-self cleavage mutation S219V, codon optimized for E. coli

This part is a TEV protease in RFC25 that was optimized for expression in E. coli. The part contains the S219V anti-self cleavage mutation.

The TEV Protease (also known as Tobaco Edge Virus nuclear inclusion a endopeptidase) is a highly sequence specific cysteine protease from the Tobacco Edge Virus (TEV). The protease is highly sequence specific. The consensus sequence for the cut is ENLYFQ\S with \ denoting the cleaved peptide bond. This sequence can be found in the part K1319016.

ENLYFQ\S is the optimal cleavage site with the highest activity but the protease is also active to a greater or lesser extent on a range of substrates. The highest cleavage is of sequences closest to the consensus EXLYΦQ\φ where X is any residue, Φ is any large or medium hydrophobic amino acid and φ is any small hydrophobic amino acid.

The TEV protease is commonly used as a biochemical tool to cleave affinity tags from purified proteins like His-Tags. The high specifity makes the protease relatively non-toxic in vitro and in vivo. The molecular weight of the TEV protease is 27 kDa.

Usage and Biology

The TEV Protease was used and characterizes in the K1319008 construct.

To characterize the TEV protease we used the fusion protein K1319014. This fusion protein contains GFP (E0040) bound to a dark quencher (REACh2/K1319002) over a linker which includes the TEV protease cleavage site. If the TEV protease successfully cuts the linker, GFP and its quencher would separate and the FRET (Förster Resonance Energy Transfer) system would be shut down. This would result in an increased GFP fluorescence.

To demonstrate this behaviour a double plasmid system was designed using the biobrick K1319013 in a pSB3K3 backbone and K1319008 in a pSB1C3 backbone. Also I20260 was used as a positive control because it produces the same GFP as used in the fusion protein and is regulated by the same promoter, RBS and Terminator on the same plasmid backbone. B0015 was used as negative control. Induction of the double plasmid constructs occured after 2 h with 50 µl of 100mM IPTG in a 50 ml shake flask culture.

Comparison of the fluorescence adjusted for OD of I20260, B0015 and the double plasmid system K1319014 + K1319008
After induction with IPTG after 2 h the double plasmid system produced a fast fluorescence response with an over 10-fold increase compared to the non induced state. I20260 served as positive control and B0015 as negative control.


The increase in fluorescence after induction with IPTG is clear sign of funtional expression of the TEV protease. The difference between not induced and induced plasmid is proof that the increase in fluorescence is only attributed to the successful cleavage of the linker. Therefore this is proof of a functional expression of the TEV protease after induction with IPTG.

Furthermore we validated the used plasmid with a Check PCR with one primer binding upstream on the plasmid backbone and one specifically in the insert.

Check PCR for K1319008
The length of the PCR product matches the length of the control plasmid.


This validates that the construct is indeed the TEV protease and thereby the functionality of the TEV protease is established. The construct K1319008 was also sequenced. The sequencing data can be seen in the parts registry here.

Sequence and Features


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    COMPATIBLE WITH RFC[21]
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    COMPATIBLE WITH RFC[25]
  • 1000
    COMPATIBLE WITH RFC[1000]


Characterization

This part was characterized by CSMU_Taiwan 2019.Because of its stringent sequence specificity, tobacco etch virus (TEV) protease emerges as a useful reagent with wide application in the cleavage of recombinant fusion proteins. Thus, we have chosen TEV protease(sequence from BBa_K1319004) to remove the fusion protein in our another part BBa_K2951008 and be characterized.

Cloning

After obtaining TEV protease sequence in pSB1C3 from iGEM 2019 distribution kit(plate 6 21N), transforming it into DH5α and performing plasmid purification, we obtained the amount of plasmids required for construction. To characterize the TEV protease, the chosen vector for expression is pET29a which includes a 6xHis-Tag fusion on the plasmid following the insert. At both anchors at the N- and C-terminus the restriction sites for BamHI and XhoI were introduced to clone the genes into a pET29a vector by PCR with overhang primers primer1(TEV-fwd) and primer2(TEV-rev).

Name 5'-3' primers sequences
TEV-fwd AATTGCGGATCCGGCGAAAGCCTGTTCAAAGGTC
TEV-rev AATTGCCTCGAGACCACCTTGGGAGTAGACCAGTTCATTC

The PCR result is observed by running a 1.8% gel and further purified(Fig.1). The modified TEV insertion were first digested with the restriction enzymes(BamH1 and Xho1)and so did the pET29a vector. (Fig.2) (We digested the insertion and vector one by one because the amount of DNA decreased significantly after the digestions on our first double digestion, and we assumed that this is the result of star effect.)


Fig.1 1.8% gel of pSB1C3-BBa_K1319004 overhang PCR and DNA purification


Fig.2 0.8% gel of pET29a digestion(the 3kb is from the original insert of the vector)

After digestion, we ligated the plasmid and the TEV insert using the T4 ligase. This sample was then transformed in E.coli DH5α for colony PCR(using primer-T7 promoter and terminator) to confirm we have successfully inserted the TEV protease sequence into pET29a(Fig.3).


Fig.2 0.8% gel of colony PCR using primers T7 promoter and terminator for pET29a.
Well 1-15:pET29a-TEV plasmid transformed in DH5α.
Well 16: control-pET29a with original insertion.

Small scale production

Cultivations and Induction of protein expression

Large scale production

Cultivations and Induction of protein expression

Protein solubility analysis

Purification and Dialysis

Enzyme activity assay

[edit]
Categories
//cds/enzyme/protease
Parameters
None