1 Registry Star
Part:BBa_J23103:Experience
This experience page is provided so that any user may enter their experience using this part.
Please enter
how you used this part and how it worked out.
Applications of BBa_J23103
Use of this promoter by team Glasgow 2014
BBa_J23116,
BBa_J23106,
BBa_J23103, and
BBa_J23112
were used to express motA and motB together in our composite biobricks:
BBa_ K1463773,
BBa_ K1463772,
BBa_ K1463770, and
BBa_ K1463771 respectively.
These composite biobricks were used to complement the swimming defect of a motA E. coli mutant.
We found that swimming was restored in the following order:
BBa_J23116 >
BBa_J23106 >
BBa_J23103 =
BBa_J23112.
Examination of the sequences of BBa_J23103 and BBa_J23112 showed that they are identical, despite showing different levels of RFP expression in their initial characterisation!
>BBa_J23103 Part-only sequence (35 bp) ctgatagctagctcagtcctagggattatgctagc
>BBa_J23112 Part-only sequence (35 bp) ctgatagctagctcagtcctagggattatgctagc
Evaluation of Anderson promoter J23103 in B. subtilis by iGEM-Team LMU-Munich 2012
This Anderson promoter was evaluated without fused RFP with the lux operon as a reporter in B. subtilis. See the new BioBrick BBa_K823007 without RFP and have a look at the [http://2012.igem.org/Team:LMU-Munich/Data/Anderson Data] from the evaluation in B. subtilis.
User Reviews
UNIQb41de2ead27fed12-partinfo-00000000-QINU
|
•••••
iGEM HKU 2011 |
To start characterizing the promoters, we have performed the red florescence intensity measurements for our selected plasmid in the E.Coli MG1655 strain. The data collected is shown below. It is found that promoter J23106 can lead to a higher expression since the fluorescence intensity per OD600 is the highest, while J23103, J23109, J23116 have relative low expression and fluorescence. As our selected promoters have different strength, thus our team is able to use them to fine tune the protein expression. UNIQb41de2ead27fed12-partinfo-00000002-QINU |
