This experience page is provided so that any user may enter their experience using this part.
Please enter
how you used this part and how it worked out.
RANDOM SEQUENCE FOUND WITHIN PART
CGCTGATAGTGCTAGTGTAGATCGC is found after the RFP stop codon and before the BioBricks suffix. Should not affect transcription or translation of RFP, but good to keep note of it especially in analyzing sequencing results. (KP of siGEM)
- Please note that the above sequence is the old "barcode" sequence added to all of the original CDSs in the early BioBrick part collections. I.e., it's not a random sequence. See https://parts.igem.org/cgi/htdocs/barcodes.cgi for more information (D. Endy).
- FURTHER NOTE The Registry is not displaying barcodes on any of the original parts. The presented sequence information is wrong. This is a serious bug in the Registry that need to be fixed (D. Endy). Drew 14:34, 1 November 2010 (UTC)
Applications of BBa_E1010
Error creating thumbnail: Invalid thumbnail parameters
User Reviews
UNIQc7e8037786b3ef2a-partinfo-00000000-QINU
•••••
Immudzen
|
As part of the 2013 CU Boulder project we worked on separating RFP from AmilCP and during that process we ran into a problem that the fluorescence of RFP is too close to the absorption of AmilCP to tell them apart. What we ended up doing was measuring the spectrum of RFP from 400nm to 600nm.
What we found is that RFP has a secondary absorbance peak at 502nm which is well clear of AmilCP. Under the devices we had access to this secondary peak also remained in the linear region of our device over a much wider concentration range.
We also found that when running on an agarose gel RFP will run down on the gel while AmilCP runs up on the gel.
|
;
•••••
HIT-Harbin
|
1)Measuring absorbance of RFP
We grew bacteria without device(BBa_J04450) and bacteria with parts BBa_J04450 in
same volume until stationary phase. Taking bacteria without device as background, we
measured the absorbance of bacteria with our device (the max absorption peak is
504nm).But absorbance in 504nm is higher than 1,which present a bad linear relation
between absorbance and concentraton. RFP has absorption in 450nm,and absorbance is
between 0.1 and 1(better linear relation).Occasionally, we find a RFP standard curve
under 450nm on the web.Before the mensuration, we diluted the two groups according to
table1. We took the mean of two measures as the useful data.
""
Fig.1 RFP absorbance varying with wave length
Table 1 Dilution of Two groups of bacteria
""
""
Fig 2. The relationship between RFP concentration and absorbance(OD450)
2)The actual relationship between RFP concentration and absorbance
""
Fig 3. RFP standard curve obtain from the web
Through the standard curve, we can convert the relative concentration to the
absolute concentration, and finally get the relationship between IPTG concentration
and RFP concentration.
Compared to crushing cells to separate RFP, our method is simpler and easy to
practice. Moreover, our relative concentration curve is credible. If the standard
curve is reliable, our calculated result of RFP will be precise.
|
;
•••••
Carnegie_Mellon 2013
|
Characterization of the Photostability of mRFP1
Photobleaching curve of mRFP1 with a HBO100 mercury-arc lamp"
XL10 Ultracompetent cells were transformed with BBa_E1010 cloned with BBa_B0034 as the RBS and BBa_R0010 as the wild-type lac promoter and induced overnight with IPTG.The overnight was bleached for 180 minutes with HBO100 (100W Mercury-arc lamp). Fluorescence data was taken using a Tecan Safire II with the parameters shown in Table 3. Fluorescence values are shown in Table 4.
Table 3 Tecan Safire II Parameters
Excitation (nm) | 585 |
Emission (nm) | 610 |
Excitation bandwidth (nm) | 10 |
Emission bandwidth (nm) | 10 |
Gain | 63 |
Number of reads | 10 |
Integration Time (microseconds) | 40 |
Table 4 Shows the fluorescence data over time during photobleaching.
Time (minutes) | Fluorescence (RFU) |
0 | 48694 |
20 | 43083 |
40 | 36842 |
60 | 30239 |
80 | 31281 |
100 | 25273 |
120 | 21467 |
140 | 18081 |
160 | 15251 |
180 | 14427 |
|
••••
KAIST_iGEM_2012
|
Figure 1. E.coli strain MG1655 expressing BBa_E1010 under control of BBa_K907005 after overnight culture. 3mL culture with M9 media in 14ml round bottom tube(left), and centrifuged cells in eppendorf tube(right). The expression of BBa_1010 is clearly observed with naked eye after overnight culture.
We recommend you to measure the emission wavelenth at 619nm. Because the maximum excitaion and emission wavelenth are too close to each other, the signal overflows. You can get more precise results with our recommendations.
BBa_E1010 was successfully used to produce mRFP in E.coli strain MG1655 in LB or M9 minimal media under the control of promoter-BBa_J23119 and RBS-BBa_B0034 in the Dual Phase Protein Generator(mRFP default), BBa_K907005
|
;
•••
DTU_igem_2010
|
Characterization of RFP BBa_E1010
We have characterized RFP BBa_E1010 in two different chassis to test the compatibility and the possible range of expressions before limitations in the cell metabolism.
Method
We have made constructs with a synthetic promoter library (SPL) in front of the E1010, by using BBa_I13507 and the plasmid backbone pSB3T5. For information on design of an SPL compatible with the BB standard see [http://bbf.openwetware.org/RFC.html#BBF_RFC_63:_DTU_Synthetic_Promoter_Library_Standard BBF RFC63].
We have benchmarked the relative promoter strength range achieved from the SPL to the standard promoter BBa_J23101, by calculating the relative promoter strength in vivo as suggested in [http://bbf.openwetware.org/RFC.html#BBF_RFC_19:_Measuring_the_Activity_of_BioBrick.E2.84.A2_Promoters_Using_an_In_Vivo_Reference_Standard BBF RFC 19]. For further explanation on methods see our [http://2010.igem.org/Team:DTU-Denmark iGEM_DTU_2010 wiki].
Results
We show that the RFP E1010 can be expressed with the following results
- In XL1blue with an RPU range form 0 to at least 1,13 RPU.
- In DHA5&alpha with an RPU range from 0 to 1,35 RPU.
Graph2 XL1BLUE illustrates the variation in promoter strengths of the SPL mapped against the reference promoters. PM corresponds to BBa_J23101, PS corresponds to BBa_J23100 and PW corresponds to BBa_J23116.
Graph3 XL1BLUEillustrates the specific activities of the SPL promoters ranked together with the reference promoters.
Graph4 DH5aillustrates the variation in promoter strengths of the SPL mapped against the reference promoters. PM corresponds to BBa_J23101, PS corresponds to BBa_J23100 and PW corresponds to BBa_J23116.
Graph5 DH5a illustrates the specific activities of the SPL promoters ranked against the reference promoters.
Table 1 shows the specific activities and RPUs calculated for all the SPL constructs run in BioLector in XL1-blue
Construct | Specific Activity | RPU |
BBa_J23101 | 0.0795 | 1.00 |
SPL_RFP01 | 0.00578 | 0.0727 |
SPL_RFP02 | 0.0418 | 0.526 |
SPL_RFP03 | 0.0612 | 0.770 |
SPL_RFP04 | -0.00027 | -0.00340 |
SPL_RFP05 | 0.0418 | 0.526 |
SPL_RFP06 | 0.0856 | 1.08 |
SPL_RFP07 | 0.0134 | 0.168 |
SPL_RFP08 | 0.0534 | 0.672 |
SPL_RFP09 | 0.0638 | 0.803 |
SPL_RFP10 | 0.00260 | 0.0327 |
SPL_RFP11 | 0.0900 | 1.13 |
SPL_RFP12 | 0.0600 | 0.755 |
SPL_RFP13 | 0.0754 | 0.949 |
SPL_RFP14 | 0.00795 | 0.100 |
SPL_RFP16 | 0.00959 | 0.121 |
Table 2 shows the specific activities and RPUs calculated for all the SPL constructs run in BioLector in DH5alpha
Construct | Specific Activity | RPU |
BBa_J23101 | 0.0712 | 1.00 |
SPL_RFP-D01 | 0.0715 | 1.00 |
SPL_RFP-D02 | 0.0959 | 1.35 |
SPL_RFPD-03 | 0.0781 | 1.10 |
SPL_RFPD-04 | 0.0531 | 0.746 |
SPL_RFPD-05 | 0.0732 | 1.03 |
SPL_RFPD-06 | 0.0552 | 0.775 |
SPL_RFPD-07 | 0.0358 | 0.503 |
SPL_RFPD-08 | 0.0668 | 0.938 |
SPL_RFPD-09 | 0.0254 | 0.357 |
SPL_RFPD-10 | 0.0165 | 0.231 |
SPL_RFPD-11 | -0.00284 | -0.399 |
SPL_RFPD-12 | 0.00276 | 0.0387 |
SPL_RFPD-13 | 0.0776 | 1.09 |
SPL_RFPD-14 | 0.0018 | 0.0253 |
SPL_RFPD-15 | 0.00302 | 0.0424 |
|
;
Antiquity
|
This review comes from the old result system and indicates that this part did not work in some test.
|
Nkessler
|
We successfully used this part for a read out system, e.g. in BBa_K389016. Additionally we compared it with a luciferase: BBa_K389004.
|
UNIQc7e8037786b3ef2a-partinfo-00000012-QINU