Part:BBa_C0062:Experience

This experience page is provided so that any user may enter their experience using this part.
Please enter how you used this part and how it worked out.

User Reviews

UNIQbb1810ac49fece0d-partinfo-00000000-QINU

•••• ETH Zurich 2014

Characterization of the promoter's sensitivity to 3OC6-HSL depending on LuxR concentration The amount of regulator LuxR (BBa_C0062) in the system was shown to influence the pLux promoter's response to the inducer concentration (3OC6-HSL). By using the three different constitutive promoters BBa_J23100, BBa_J23109, and BBa_J23111 for the production of LuxR we have measured this effect in terms of fluorescence (see figure 1). Background information Results Figure 1 Characterization of two-order crosstalk Background information Here, we focus on the characterization of crosstalk of LuxR with different AHLs and further crosstalk of LuxR-3OC6-HSL with the three promoters - pLux, pLas, and pRhl. In the following, we describe all the different levels of crosstalk we have assessed. First-order crosstalk In the first order crosstalk section we describe activation of pLux due to LuxR binding to inducers different from 3OC6-HSL or pLux itself binding a regulator-inducer pair different from LuxR-3OC6-HSL. First Level crosstalk: LuxR binds to different HSL and activates the promoter Plux In the conventional system 3OC6-HSL binds to its corresponding regulator, LuxR, and activates the pLux promoter (figure 2, light blue). However, LuxR can potentially also bind to other AHLs and then activate pLux (figure 2, 3OC12-HSL in red and C4-HSL in green). Second Level crosstalk: LuxR binds to 3OC6-HSL, its natural HSL, and activates different promoters Second order crosstalk: Combination of both cross-talk levels LuxR can bind to it's native or other AHLs and activates three promoters. Results Table 1 Crosstalk matrix for the regulator LuxR (BBa_C0062) In all the measurements conducted to create this matrix the regulator LuxR was the basis and was induced in six different variations shown. Modeling crosstalk Each experimental data set was fitted to an Hill function using the Least Absolute Residual method. The fitting of the graphs was performed using the following equation : rFluo = the relative fluorescence (absolute measured fluorescence value over OD)[a.u.] a = basal expression rate [a.u.](“leakiness”) b = maximum expression rate [a.u.]("full induction") n = Hill coefficient (“cooperativity”) Km = Half-maximal effective concentration (“sensitivity”) [AHL]= AHL concentration [nM] Parameters of HillFunction for crosstalk with LuxR (with 95% confidence bounds) 3OC6-HSL 3OC12-HSL C4-HSL Plux a = 1043 (966.8, 1139) [a.u.] n = 0.89 (0.79, 0.99) Km = 0.1892 (0.1392, 0.2391) [nM] b = 2.129e4 (2.065e4, 2.192e4) [a.u.] a = 900.5 (882, 918.9) [a.u.] n = 1.049 (0.9976, 1.1) Km = 78.32 (73.18, 83.47) [nM] b = 1.866e4 (1.834e4, 1.899e4) [a.u.] No crosstalk Plas a = 3.996 (0, 9.185) [a.u.] n = 0.5198 (0.2879, 0.7517) Km = 382.3 (0, 1206) [nM] b = 261 (155.5, 366.5) [a.u.] No crosstalk No crosstalk Prhl No crosstalk No crosstalk No crosstalk

••••• SUN(Tsinghua)

Part was sequenced and functional. LuxR was used in our Portable Pathogen Detector.

;

••••• wmholtz

Using this part, I have successfully constructed and tested a quorum sensing circuit in E. coli.

;

••••• Youri

This part was used and tested as a subpart in K546000, K546001, K546002, K546003, K546005 and K546546. This part functioned in all cases.

;

Kevin (iGEM Braunschweig 2013)

The plasmid pSB1C3 BBa_C0062 from the 2013 distribution Kit was transformed in E. coli XL1 BlueMRF. Sequencing with standard verification primer VF2 confirmed matching sequence of backbone DNA up to the EcoRI restriction site. The rest of the sequence (not shown) does not match the registry entry. 96 145 pSB1C3 LuxR (96) GAGGCAGAATTTCAGATAAAAAAAATCCTTAGCTTTCGCTAAGGATGATT C0062 VF2 (1) GAGGCAGAATTTCAGATAAAAAAAATCCTTAGCTTTCGCTAAGGATGATT 146 195 pSB1C3 LuxR (146) TCTGGAATTCGCGGCCGCTTCTAGAGATGAAAAACATAAATGCCGACGAC C0062 VF2 (51) TCTGGAATTCGACGCAA-TGGGTGCGCTGTCTACTAAATACAACGACACC 196 245 pSB1C3 LuxR (196) ACATACAGAATAATTAATAAAATTAAAGCTTGTAGAAGCAATAATGATAT C0062 VF2 (100) CCGGAAAAAGCCTCCCGTACTTACGACGCTCACCGTGACGGTTTCGTTAT 246 pSB1C3 LuxR (246) TAATCAATGC... C0062 VF2 (150) CGCTGGCGGC... A restriction assay (Figure 1) showed that the sequenced part has no XbaI restriction site following the EcoRI site indicating another part in front of BBa_C0062 with a length of at least 1000 bp.

;

UNIQbb1810ac49fece0d-partinfo-00000007-QINU