Promoters/Catalog/B. subtilis/Constitutive
The promoters here are B. subtilis promoters that are constitutive meaning that the activity of these promoters should only be regulated by the levels of RNA polymerase and the appropriate σ factor.
Constitutive B. subtilis σA promoters
This section lists promoters that are recognized by B. subtilis σA RNAP. σA is the major B. subtilis sigma factor so there should be RNAP present to transcribe these promoters under most growth conditions (although maximally during exponential growth).
Name | Description | Promoter Sequence | Positive Regulators | Negative Regulators | Length | Doc | Status |
---|---|---|---|---|---|---|---|
BBa_K143012 | Promoter veg a constitutive promoter for B. subtilis | . . . aaaaatgggctcgtgttgtacaataaatgt | 97 | 6561 | In stock | ||
BBa_K143013 | Promoter 43 a constitutive promoter for B. subtilis | . . . aaaaaaagcgcgcgattatgtaaaatataa | 56 | 11873 | Not in stock | ||
BBa_K780003 | Strong constitutive promoter for Bacillus subtilis | . . . aattgcagtaggcatgacaaaatggactca | 36 | 1559 | It's complicated | ||
BBa_K823000 | PliaG | . . . caagcttttcctttataatagaatgaatga | 121 | 7765 | In stock | ||
BBa_K823002 | PlepA | . . . tctaagctagtgtattttgcgtttaatagt | 157 | 7245 | In stock | ||
BBa_K823003 | Pveg | . . . aatgggctcgtgttgtacaataaatgtagt | 237 | 14126 | In stock |
Constitutive B. subtilis σB promoters
This section lists promoters that are recognized by B. subtilis σB RNAP. σB is the major stationary phase E. coli sigma factor. Use these promoters when you want high promoter activity during stationary phase or during starvation.
Name | Description | Promoter Sequence | Positive Regulators | Negative Regulators | Length | Doc | Status |
---|---|---|---|---|---|---|---|
BBa_K143010 | Promoter ctc for B. subtilis | . . . atccttatcgttatgggtattgtttgtaat | 56 | 4297 | Not in stock | ||
BBa_K143011 | Promoter gsiB for B. subtilis | . . . taaaagaattgtgagcgggaatacaacaac | 38 | 2765 | Not in stock | ||
BBa_K143013 | Promoter 43 a constitutive promoter for B. subtilis | . . . aaaaaaagcgcgcgattatgtaaaatataa | 56 | 11873 | Not in stock |