Difference between revisions of "Part:BBa K2009666"

 
 
Line 1: Line 1:
 +
<partinfo>BBa_K2009666 short</partinfo>
  
 +
<p style="font-weight:bold; font-size:20px;">Squence And Features</p>
 +
<partinfo>BBa_K2009666 SequenceAndFeatures</partinfo>
 +
 +
<p style="font-weight:bold; font-size:20px;">Introduction</p>
 +
<hr/>
 +
 +
 +
sfGFP1-10——PSB1A3 length: 706bp
 +
<br>
 +
Derived from: PCR from Part:<html>
 +
<a href="https://parts.igem.org/Part:BBa_I746916"> BBa_I746916 </a>
 +
</html>，Cambridge 2008
 +
 +
<br>
 +
<html>
 +
<a href="https://parts.igem.org/Part:BBa_J23100"> BBa_J23100 </a>
 +
</html>: promoter:
 +
<br>
 +
<html>
 +
<a href="https://parts.igem.org/Part:BBa_B0030"> BBa_B0030 </a>
 +
</html>: RBS
 +
sfGFP1-10——PSB1A3 is an expression plasmid which insertsfGFP1-10 into PSB1A3.
 +
 +
PSB1A3 is a high copy numberplasmid carrying ampicillin resistance. The replication origin is aPUC19-derived pMB1.
 +
 +
SfGFP1-10 is a part of GFP(from 1bp to 214bp), GFP has been mutated to improve its solubilityand self-associating activity. When it express, it will emit green fluorescenceslightly under the fluorescence microscope.
 +
 +
We try to find anideal protein tag to be work both invivo and invitro and it can provide a sensitive measurable signalwhich don’t need external chemical reagents or substrates. Finally we find away to accomplish this goal—— dividing GFP into sfGFP1-10and sfGFP11. Either the sfGFP1-10 or sfGFP11 will emit green fluorescence slightly under the fluorescencemicroscope. However, when sfGFP1-10 and sfGFP11 express insame cell, they will interact each other and emit more intense fluorescence thaneach of them. The split GFP system is simple and does not change fusion proteinsolubility.
 +
 +
Primers for these biobrickvectors can be found in part:
 +
<br>
 +
<html>
 +
<a href="https://parts.igem.org/Part:BBa_G00100"> BBa_G00100 (aka VF2) </a>
 +
</html>
 +
<br>
 +
<html>
 +
<a href="https://parts.igem.org/Part:BBa_G00101"> BBa_G00101 (akaVR) </a>
 +
</html>
 +
<br>
 +
 +
 +
<hr/>
 +
The split GFP system has manypractical applications. Obtaining soluble, well-folded recombinant proteins fordownstream applications requires screening large numbers of protein variants (mutants,fragments, fusion tags, folding partners) and testing many expression orrefolding conditions.(Ste´phanieCabantous, Thomas C Terwilliger & Geoffrey S Waldo,2005)
 +
 +
<p style="font-weight:bold; font-size:20px;">Part Sequence</p>
 +
<hr/>
 +
 +
<html>
 +
<div style="max-width:100%; overflow:scroll;">
 +
ttgacggctagctcagtcctaggtacagtgctagctactagagattaaagaggagaaatactagatgcgtaaaggcgaagagctgttcactggtgtcgtccctattctggtggaactggatggtgatgtcaacggtcataagttttccgtgcgtggcgagggtgaaggtgacgcaactaatggtaaactgacgctgaagttcatctgtactactggtaaactgccggtaccttggccgactctggtaacgacgctgacttatggtgttcagtgctttgctcgttatccggaccatatgaagcagcatgacttcttcaagtccgccatgccggaaggctatgtgcaggaacgcacgatttcctttaaggatgacggcacgtacaaaacgcgtgcggaagtgaaatttgaaggcgataccctggtaaaccgcattgagctgaaaggcattgactttaaagaagacggcaatatcctgggccataagctggaatacaattttaacagccacaatgtttacatcaccgccgataaacaaaaaaatggcattaaagcgaattttaaaattcgccacaacgtggaggatggcagcgtgcagctggctgatcactaccagcaaaacactccaatcggtgatggtcctgttctgctgccagacaatcactatctgagcacgcaaagcgttctgtctaaagatccgaacgagaaa</div>
 +
</html>
 +
(All the sequence has been testified by Sangon)
 +
 +
<p style="font-weight:bold; font-size:20px;">Assume Protein Structure</p>
 +
<hr/>
 +
 +
We used Phyre2 to get the assume structure:
 +
 +
<html>
 +
<img src="https://static.igem.org/mediawiki/parts/c/c8/T--USTC--sfGFP1-10.png">
 +
</html>
 +
 +
(by PyMOL)
 +
 +
Citation:
 +
 +
The Phyre2 web portal for protein modeling, prediction and analysis
 +
 +
Kelley LA et al.
 +
 +
Nature Protocols 10, 845-858 (2015).
 +
 +
<!-- Add more about the biology of this part here
 +
===Usage and Biology===
 +
 +
<!-- --> 
 +
 +
 +
 +
<!-- Uncomment this to enable Functional Parameter display
 +
===Functional Parameters===
 +
<partinfo>BBa_K2009666 parameters</partinfo>
 +
<!-- -->

Latest revision as of 03:35, 16 September 2016

sfGFP1-10 with promoter and RBS

Squence And Features


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    INCOMPATIBLE WITH RFC[12]
    Illegal NheI site found at 7
    Illegal NheI site found at 30
  • 21
    COMPATIBLE WITH RFC[21]
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    COMPATIBLE WITH RFC[25]
  • 1000
    INCOMPATIBLE WITH RFC[1000]
    Illegal SapI.rc site found at 77

Introduction


sfGFP1-10——PSB1A3 length: 706bp
Derived from: PCR from Part: BBa_I746916 ，Cambridge 2008


BBa_J23100 : promoter:
BBa_B0030 : RBS sfGFP1-10——PSB1A3 is an expression plasmid which insertsfGFP1-10 into PSB1A3.

PSB1A3 is a high copy numberplasmid carrying ampicillin resistance. The replication origin is aPUC19-derived pMB1.

SfGFP1-10 is a part of GFP(from 1bp to 214bp), GFP has been mutated to improve its solubilityand self-associating activity. When it express, it will emit green fluorescenceslightly under the fluorescence microscope.

We try to find anideal protein tag to be work both invivo and invitro and it can provide a sensitive measurable signalwhich don’t need external chemical reagents or substrates. Finally we find away to accomplish this goal—— dividing GFP into sfGFP1-10and sfGFP11. Either the sfGFP1-10 or sfGFP11 will emit green fluorescence slightly under the fluorescencemicroscope. However, when sfGFP1-10 and sfGFP11 express insame cell, they will interact each other and emit more intense fluorescence thaneach of them. The split GFP system is simple and does not change fusion proteinsolubility.

Primers for these biobrickvectors can be found in part:
BBa_G00100 (aka VF2)
BBa_G00101 (akaVR)


The split GFP system has manypractical applications. Obtaining soluble, well-folded recombinant proteins fordownstream applications requires screening large numbers of protein variants (mutants,fragments, fusion tags, folding partners) and testing many expression orrefolding conditions.(Ste´phanieCabantous, Thomas C Terwilliger & Geoffrey S Waldo,2005)

Part Sequence

ttgacggctagctcagtcctaggtacagtgctagctactagagattaaagaggagaaatactagatgcgtaaaggcgaagagctgttcactggtgtcgtccctattctggtggaactggatggtgatgtcaacggtcataagttttccgtgcgtggcgagggtgaaggtgacgcaactaatggtaaactgacgctgaagttcatctgtactactggtaaactgccggtaccttggccgactctggtaacgacgctgacttatggtgttcagtgctttgctcgttatccggaccatatgaagcagcatgacttcttcaagtccgccatgccggaaggctatgtgcaggaacgcacgatttcctttaaggatgacggcacgtacaaaacgcgtgcggaagtgaaatttgaaggcgataccctggtaaaccgcattgagctgaaaggcattgactttaaagaagacggcaatatcctgggccataagctggaatacaattttaacagccacaatgtttacatcaccgccgataaacaaaaaaatggcattaaagcgaattttaaaattcgccacaacgtggaggatggcagcgtgcagctggctgatcactaccagcaaaacactccaatcggtgatggtcctgttctgctgccagacaatcactatctgagcacgcaaagcgttctgtctaaagatccgaacgagaaa
(All the sequence has been testified by Sangon)

Assume Protein Structure

We used Phyre2 to get the assume structure:

(by PyMOL)

Citation:

The Phyre2 web portal for protein modeling, prediction and analysis

Kelley LA et al.

Nature Protocols 10, 845-858 (2015).