Difference between revisions of "Promoters/Catalog/B. subtilis/Constitutive"
Line 1: Line 1:
 
[[Image:ConstitutivePromoter.png|right|200px]]
 
[[Image:ConstitutivePromoter.png|right|200px]]
−
The promoters here are ''B. subtilis'' promoters that are '''constitutive''' meaning that the activity of these promoters should only be regulated by the levels of RNA polymerase and the appropriate σ factor.
+
The promoters of this section are ''B. subtilis'' promoters. The list beyond is the list of the promoters that are said to be '''constitutive'''. This means that their activity is supposed no to be regulated by any component of cell, and the gene should be transcribed all the time.
 +
 
 +
The sequence of these promoter are adapted to the σ factor of ''B. subtilis''. However, some of these promoter also works in ''E. coli''. Generally speaking, standard ''E. coli'' promoters don't work (or are very weak) in ''B. subtilis'' strains, whereas the contrary generally works. However, it doesn't mean that the efficiency will be the same in both strains. The pVeg promoter, for instance, works fine at a high level of expression in both ''E. coli'' and ''B. subtilis'' strains
 +
 
 +
 
 
<br style="clear:both" />
 
<br style="clear:both" />
  
 
===Constitutive ''B. subtilis'' &sigma;<sup>A</sup> promoters===
 
===Constitutive ''B. subtilis'' &sigma;<sup>A</sup> promoters===
−
This section lists promoters that are recognized by [[Help:Promoters/Prokaryotic RNAP#E. coli RNA polymerases|''B. subtilis'' &sigma;<sup>A</sup> RNAP]].  &sigma;<sup>A</sup> is the major ''B. subtilis'' sigma factor so there should be RNAP present to transcribe these promoters under most growth conditions (although maximally during exponential growth).<br>
+
 
 +
This section lists promoters that are recognized by [[Help:Promoters/Prokaryotic RNAP#E. coli RNA polymerases|''B. subtilis'' &sigma;<sup>A</sup> RNAP]].  &sigma;<sup>A</sup> is the major ''B. subtilis'' sigma factor, that recruit the rest of the complex forming the RNA polymerase. These promoters are generally active under most of the growth conditions (although the activity is maximal during the exponential growth phase).<br>
  
 
<parttable>promoter_subtilis_constitutive_sigmaA</parttable>
 
<parttable>promoter_subtilis_constitutive_sigmaA</parttable>

Revision as of 13:37, 31 October 2011

ConstitutivePromoter.png

The promoters of this section are B. subtilis promoters. The list beyond is the list of the promoters that are said to be constitutive. This means that their activity is supposed no to be regulated by any component of cell, and the gene should be transcribed all the time.

The sequence of these promoter are adapted to the σ factor of B. subtilis. However, some of these promoter also works in E. coli. Generally speaking, standard E. coli promoters don't work (or are very weak) in B. subtilis strains, whereas the contrary generally works. However, it doesn't mean that the efficiency will be the same in both strains. The pVeg promoter, for instance, works fine at a high level of expression in both E. coli and B. subtilis strains



Constitutive B. subtilis σA promoters

This section lists promoters that are recognized by B. subtilis σA RNAP. σA is the major B. subtilis sigma factor, that recruit the rest of the complex forming the RNA polymerase. These promoters are generally active under most of the growth conditions (although the activity is maximal during the exponential growth phase).


More...
NameDescriptionPromoter SequencePositive
Regulators		Negative
Regulators		LengthDocStatus
BBa_K143012Promoter veg a constitutive promoter for B. subtilis . . . aaaaatgggctcgtgttgtacaataaatgt976561In stock
BBa_K143013Promoter 43 a constitutive promoter for B. subtilis . . . aaaaaaagcgcgcgattatgtaaaatataa5611873Not in stock
BBa_K780003Strong constitutive promoter for Bacillus subtilis . . . aattgcagtaggcatgacaaaatggactca361559It's complicated
BBa_K823000PliaG . . . caagcttttcctttataatagaatgaatga1217765In stock
BBa_K823002PlepA . . . tctaagctagtgtattttgcgtttaatagt1577245In stock
BBa_K823003Pveg . . . aatgggctcgtgttgtacaataaatgtagt23714126In stock

Constitutive B. subtilis σB promoters

This section lists promoters that are recognized by B. subtilis σB RNAP. σB is the major stationary phase E. coli sigma factor. Use these promoters when you want high promoter activity during stationary phase or during starvation.


More...
NameDescriptionPromoter SequencePositive
Regulators		Negative
Regulators		LengthDocStatus
BBa_K143010Promoter ctc for B. subtilis . . . atccttatcgttatgggtattgtttgtaat564297Not in stock
BBa_K143011Promoter gsiB for B. subtilis . . . taaaagaattgtgagcgggaatacaacaac382765Not in stock
BBa_K143013Promoter 43 a constitutive promoter for B. subtilis . . . aaaaaaagcgcgcgattatgtaaaatataa5611873Not in stock