Difference between revisions of "Promoters/Catalog/Negative"

Line 25: Line 25:
  
  
 +
[[Image:NegativePromoter.png|right|200px]]
 +
The promoters here are ''B. subtilis'' promoters that are '''negatively regulated''' meaning that increased levels of at least one transcription factor (other than the sigma factor) will decrease the activity of these promoters.
 +
<br style="clear:both" />
 +
 +
==Negatively regulated ''B. subtilis'' promoters==
 +
===Repressible ''B. subtilis'' &sigma;<sup>A</sup> promoters===
 +
This section lists promoters that are recognized by [[Help:Promoters/Prokaryotic RNAP#E. coli RNA polymerases|''B. subtilis'' &sigma;<sup>A</sup> RNAP]].  &sigma;<sup>A</sup> is the major ''B. subtilis'' sigma factor so there should be RNAP present to transcribe these promoters under most growth conditions (although maximally during exponential growth).<br>
 +
 +
<parttable>promoter_subtilis_negative_sigmaA</parttable>
 +
 +
===Repressible ''B. subtilis'' &sigma;<sup>B</sup> promoters===
 +
This section lists promoters that are recognized by [[Help:Promoters/Prokaryotic RNAP#E. coli RNA polymerases|''B. subtilis'' &sigma;<sup>B</sup> RNAP]].  &sigma;<sup>B</sup> is the major stationary phase ''E. coli'' sigma factor.  Use these promoters when you want high promoter activity during stationary phase or during starvation.  <br>
 +
 +
<parttable>promoter_subtilis_negative_sigmaB</parttable>
  
 
<html>
 
<html>

Revision as of 03:57, 17 May 2009

NegativePromoter.png

All the promoters on this page are negatively regulated meaning that increased levels of at least one transcription factor (other than the sigma factor) will decrease the activity of these promoters.

Negatively regulated E. coli promoters

Negatively regulated E. coli σ70 promoters

This section lists promoters that are recognized by E. coli σ70 RNAP. σ70 is the major E. coli sigma factor so there should be RNAP present to transcribe these promoters under most growth conditions (although maximally during exponential growth).


More...
NameDescriptionPromoter SequencePositive
Regulators
Negative
Regulators
LengthDocStatus
BBa_I1051Lux cassette right promoter . . . tgttatagtcgaatacctctggcggtgata681735In stock
BBa_I12001Promoter (PRM+) . . . gatttaacgtatcagcacaaaaaagaaacc961424Not in stock
BBa_I12006Modified lamdba Prm promoter (repressed by 434 cI) . . . attacaaactttcttgtatagatttaacgt825124In stock
BBa_I12036Modified lamdba Prm promoter (cooperative repression by 434 cI) . . . tttcttgtatagatttacaatgtatcttgt912153In stock
BBa_I12040Modified lambda P(RM) promoter: -10 region from P(L) and cooperatively repressed by 434 cI . . . tttcttgtagatacttacaatgtatcttgt912572In stock
BBa_I12212TetR - TetR-4C heterodimer promoter (negative) . . . actctgtcaatgatagagtggattcaaaaa611774Not in stock
BBa_I14015P(Las) TetO . . . ttttggtacactccctatcagtgatagaga1701524In stock
BBa_I14016P(Las) CIO . . . ctttttggtacactacctctggcggtgata1681523In stock
BBa_I14032promoter P(Lac) IQ . . . aaacctttcgcggtatggcatgatagcgcc373527In stock
BBa_I714889OR21 of PR and PRM . . . tattttacctctggcggtgataatggttgc1011491It's complicated
BBa_I714924RecA_DlexO_DLacO1 . . . actctcggcatggacgagctgtacaagtaa8622343It's complicated
BBa_I715003hybrid pLac with UV5 mutation . . . ttgtgagcggataacaatatgttgagcaca551595Not in stock
BBa_I718018dapAp promoter . . . cattgagacacttgtttgcacagaggatgg811841In stock
BBa_I731004FecA promoter . . . ttctcgttcgactcatagctgaacacaaca90814Not in stock
BBa_I732200NOT Gate Promoter Family Member (D001O1wt1) . . . gaattgtgagcggataacaattggatccgg1251107Not in stock
BBa_I732201NOT Gate Promoter Family Member (D001O11) . . . ggaattgtgagcgctcacaattggatccgg1241545Not in stock
BBa_I732202NOT Gate Promoter Family Member (D001O22) . . . ggaattgtaagcgcttacaattggatccgg1241435Not in stock
BBa_I732203NOT Gate Promoter Family Member (D001O33) . . . ggaattgtaaacgtttacaattggatccgg1241435Not in stock
BBa_I732204NOT Gate Promoter Family Member (D001O44) . . . ggaattgtgaacgttcacaattggatccgg1241435Not in stock
BBa_I732205NOT Gate Promoter Family Member (D001O55) . . . ggaattttgagcgctcaaaattggatccgg1241435In stock
BBa_I732206NOT Gate Promoter Family Member (D001O66) . . . ggaattatgagcgctcataattggatccgg1241291Not in stock
BBa_I732207NOT Gate Promoter Family Member (D001O77) . . . gggacgactgtatacagtcgtcggatccgg1241294Not in stock
BBa_I732270Promoter Family Member with Hybrid Operator (D001O12) . . . ggaattgtgagcgcttacaattggatccgg1241351Not in stock
BBa_I732271Promoter Family Member with Hybrid Operator (D001O16) . . . ggaattgtgagcgctcataattggatccgg1241351Not in stock
BBa_I732272Promoter Family Member with Hybrid Operator (D001O17) . . . ggaattgtgagctacagtcgtcggatccgg1241351Not in stock
BBa_I732273Promoter Family Member with Hybrid Operator (D001O21) . . . ggaattgtaagcgctcacaattggatccgg1241351Not in stock
BBa_I732274Promoter Family Member with Hybrid Operator (D001O24) . . . ggaattgtaagcgttcacaattggatccgg1241351Not in stock
BBa_I732275Promoter Family Member with Hybrid Operator (D001O26) . . . ggaattgtaagcgctcataattggatccgg1241351Not in stock
BBa_I732276Promoter Family Member with Hybrid Operator (D001O27) . . . ggaattgtaagctacagtcgtcggatccgg1241351Not in stock
BBa_I732277Promoter Family Member with Hybrid Operator (D001O46) . . . ggaattgtgaacgctcataattggatccgg1241351Not in stock
BBa_I732278Promoter Family Member with Hybrid Operator (D001O47) . . . ggaattgtgaactacagtcgtcggatccgg1241351Not in stock
BBa_I732279Promoter Family Member with Hybrid Operator (D001O61) . . . ggaattatgagcgctcacaattggatccgg1241351Not in stock
BBa_I732301NAND Candidate (U073O26D001O16) . . . ggaattgtgagcgctcataattggatccgg1201336Not in stock
BBa_I732302NAND Candidate (U073O27D001O17) . . . ggaattgtgagctacagtcgtcggatccgg1201362Not in stock
BBa_I732303NAND Candidate (U073O22D001O46) . . . ggaattgtgaacgctcataattggatccgg1201330Not in stock
BBa_I732304NAND Candidate (U073O22D001O47) . . . ggaattgtgaactacagtcgtcggatccgg1201159Not in stock
BBa_I732305NAND Candidate (U073O22D059O46) . . . taaattgtgaacgctcataattggatccgg1781193Not in stock
BBa_I732306NAND Candidate (U073O11D002O22) . . . gaaattgtaagcgcttacaattggatccgg1211323Not in stock
BBa_I732351NOR Candidate (U037O11D002O22) . . . gaaattgtaagcgcttacaattggatccgg851333Not in stock
BBa_I732352NOR Candidate (U035O44D001O22) . . . ggaattgtaagcgcttacaattggatccgg821326Not in stock
BBa_I732400Promoter Family Member (U097NUL+D062NUL) . . . gccaaattaaacaggattaacaggatccgg1652515Not in stock
BBa_I732401Promoter Family Member (U097O11+D062NUL) . . . gccaaattaaacaggattaacaggatccgg1851233Not in stock
BBa_I732402Promoter Family Member (U085O11+D062NUL) . . . gccaaattaaacaggattaacaggatccgg1731271Not in stock
BBa_I732403Promoter Family Member (U073O11+D062NUL) . . . gccaaattaaacaggattaacaggatccgg1611271Not in stock
BBa_I732404Promoter Family Member (U061O11+D062NUL) . . . gccaaattaaacaggattaacaggatccgg1491275Not in stock
BBa_I732405Promoter Family Member (U049O11+D062NUL) . . . gccaaattaaacaggattaacaggatccgg1371271Not in stock
BBa_I732406Promoter Family Member (U037O11+D062NUL) . . . gccaaattaaacaggattaacaggatccgg1251273Not in stock
BBa_I732407Promoter Family Member (U097NUL+D002O22) . . . gaaattgtaagcgcttacaattggatccgg1251275Not in stock
BBa_I732408Promoter Family Member (U097NUL+D014O22) . . . taaattgtaagcgcttacaattggatccgg1371275Not in stock
BBa_I732409Promoter Family Member (U097NUL+D026O22) . . . gtaattgtaagcgcttacaattggatccgg1491275Not in stock
BBa_I732410Promoter Family Member (U097NUL+D038O22) . . . tcaattgtaagcgcttacaattggatccgg1611297Not in stock
BBa_I732411Promoter Family Member (U097NUL+D050O22) . . . aaaattgtaagcgcttacaattggatccgg1731297Not in stock
BBa_I732412Promoter Family Member (U097NUL+D062O22) . . . caaattgtaagcgcttacaattggatccgg1851297Not in stock
BBa_I732413Promoter Family Member (U097O11+D002O22) . . . gaaattgtaagcgcttacaattggatccgg1451233Not in stock
BBa_I732414Promoter Family Member (U097O11+D014O22) . . . taaattgtaagcgcttacaattggatccgg1571233Not in stock
BBa_I732415Promoter Family Member (U097O11+D026O22) . . . gtaattgtaagcgcttacaattggatccgg1691233Not in stock
BBa_I732416Promoter Family Member (U097O11+D038O22) . . . tcaattgtaagcgcttacaattggatccgg1811233Not in stock
BBa_I732417Promoter Family Member (U097O11+D050O22) . . . aaaattgtaagcgcttacaattggatccgg1931233Not in stock
BBa_I732418Promoter Family Member (U097O11+D062O22) . . . caaattgtaagcgcttacaattggatccgg2051233Not in stock
BBa_I732419Promoter Family Member (U085O11+D002O22) . . . gaaattgtaagcgcttacaattggatccgg1331233Not in stock
BBa_I732420Promoter Family Member (U085O11+D014O22) . . . taaattgtaagcgcttacaattggatccgg1451233Not in stock
BBa_I732421Promoter Family Member (U085O11+D026O22) . . . gtaattgtaagcgcttacaattggatccgg1571233Not in stock
BBa_I732422Promoter Family Member (U085O11+D038O22) . . . tcaattgtaagcgcttacaattggatccgg1691233Not in stock
BBa_I732423Promoter Family Member (U085O11+D050O22) . . . aaaattgtaagcgcttacaattggatccgg1811233Not in stock
BBa_I732424Promoter Family Member (U085O11+D062O22) . . . caaattgtaagcgcttacaattggatccgg1931233Not in stock
BBa_I732425Promoter Family Member (U073O11+D002O22) . . . gaaattgtaagcgcttacaattggatccgg1211233Not in stock
BBa_I732426Promoter Family Member (U073O11+D014O22) . . . taaattgtaagcgcttacaattggatccgg1331233Not in stock
BBa_I732427Promoter Family Member (U073O11+D026O22) . . . gtaattgtaagcgcttacaattggatccgg1451233Not in stock
BBa_I732428Promoter Family Member (U073O11+D038O22) . . . tcaattgtaagcgcttacaattggatccgg1571233Not in stock
BBa_I732429Promoter Family Member (U073O11+D050O22) . . . aaaattgtaagcgcttacaattggatccgg1691233Not in stock
BBa_I732430Promoter Family Member (U073O11+D062O22) . . . caaattgtaagcgcttacaattggatccgg1811233Not in stock
BBa_I732431Promoter Family Member (U061O11+D002O22) . . . gaaattgtaagcgcttacaattggatccgg1091233Not in stock
BBa_I732432Promoter Family Member (U061O11+D014O22) . . . taaattgtaagcgcttacaattggatccgg1211233Not in stock
BBa_I732433Promoter Family Member (U061O11+D026O22) . . . gtaattgtaagcgcttacaattggatccgg1331233Not in stock
BBa_I732434Promoter Family Member (U061O11+D038O22) . . . tcaattgtaagcgcttacaattggatccgg1451233Not in stock
BBa_I732435Promoter Family Member (U061O11+D050O22) . . . aaaattgtaagcgcttacaattggatccgg1571233Not in stock
BBa_I732436Promoter Family Member (U061O11+D062O22) . . . caaattgtaagcgcttacaattggatccgg1691233Not in stock
BBa_I732437Promoter Family Member (U049O11+D002O22) . . . gaaattgtaagcgcttacaattggatccgg971233Not in stock
BBa_I732438Promoter Family Member (U049O11+D014O22) . . . taaattgtaagcgcttacaattggatccgg1091233Not in stock
BBa_I732439Promoter Family Member (U049O11+D026O22) . . . gtaattgtaagcgcttacaattggatccgg1211233Not in stock
BBa_I732440Promoter Family Member (U049O11+D038O22) . . . tcaattgtaagcgcttacaattggatccgg1331233Not in stock
BBa_I732441Promoter Family Member (U049O11+D050O22) . . . aaaattgtaagcgcttacaattggatccgg1451233Not in stock
BBa_I732442Promoter Family Member (U049O11+D062O22) . . . caaattgtaagcgcttacaattggatccgg1571233Not in stock
BBa_I732443Promoter Family Member (U037O11+D002O22) . . . gaaattgtaagcgcttacaattggatccgg851233Not in stock
BBa_I732444Promoter Family Member (U037O11+D014O22) . . . taaattgtaagcgcttacaattggatccgg971233Not in stock
BBa_I732445Promoter Family Member (U037O11+D026O22) . . . gtaattgtaagcgcttacaattggatccgg1091233Not in stock
BBa_I732446Promoter Family Member (U037O11+D038O22) . . . tcaattgtaagcgcttacaattggatccgg1211233Not in stock
BBa_I732447Promoter Family Member (U037O11+D050O22) . . . aaaattgtaagcgcttacaattggatccgg1331233Not in stock
BBa_I732448Promoter Family Member (U037O11+D062O22) . . . caaattgtaagcgcttacaattggatccgg1451233Not in stock
BBa_I732450Promoter Family Member (U073O26+D062NUL) . . . gccaaattaaacaggattaacaggatccgg1611233Not in stock
BBa_I732451Promoter Family Member (U073O27+D062NUL) . . . gccaaattaaacaggattaacaggatccgg1611233Not in stock
BBa_I732452Promoter Family Member (U073O26+D062O61) . . . caaattatgagcgctcacaattggatccgg1811233It's complicated
BBa_I739101Double Promoter (constitutive / TetR, negative) . . . tgatagagattccctatcagtgatagagat833196Not in stock
BBa_I739102Double Promoter (cI, negative / TetR, negative) . . . tgatagagattccctatcagtgatagagat973216Not in stock
BBa_I739103Double Promoter (lacI, negative / P22 cII, negative) . . . gttctttaattatttaagtgttctttaatt873188Not in stock
BBa_I739104Double Promoter (LuxR/HSL, positive / P22 cII, negative) . . . gttctttaattatttaagtgttctttaatt1013261Not in stock
BBa_I739105Double Promoter (LuxR/HSL, positive / cI, negative) . . . cgtgcgtgttgataacaccgtgcgtgttga993259Not in stock
BBa_I739106Double Promoter (TetR, negative / P22 cII, negative) . . . gtgttctttaatatttaagtgttctttaat843245Not in stock
BBa_I739107Double Promoter (cI, negative / LacI, negative) . . . ggaattgtgagcggataacaatttcacaca783009Not in stock
BBa_I746665Pspac-hy promoter . . . tgtgtgtaattgtgagcggataacaattaa582958Not in stock
BBa_I751500pcI (for positive control of pcI-lux hybrid promoter) . . . ttttacctctggcggtgataatggttgcag771165Not in stock
BBa_I751501plux-cI hybrid promoter . . . gtgttgatgcttttatcaccgccagtggta661222Not in stock
BBa_I751502plux-lac hybrid promoter . . . agtgtgtggaattgtgagcggataacaatt744200Not in stock
BBa_I756014LexAoperator-MajorLatePromoter . . . agggggtgggggcgcgttggcgcgccacac2291516Not in stock
BBa_I761011CinR, CinL and glucose controlled promotor . . . acatcttaaaagttttagtatcatattcgt2952080It's complicated
BBa_J05209Modifed Pr Promoter . . . tattttacctctggcggtgataatggttgc491265In stock
BBa_J05210Modifed Prm+ Promoter . . . atttataaatagtggtgatagatttaacgt821268In stock
BBa_J07019FecA Promoter (with Fur box) . . . acccttctcgttcgactcatagctgaacac861545It's complicated
BBa_J15301Pars promoter from Escherichia coli chromosomal ars operon. . . . tgacttatccgcttcgaagagagacactac1272472Not in stock
BBa_J22052Pcya . . . aggtgttaaattgatcacgttttagaccat651885Not in stock
BBa_J22106rec A (SOS) Promoter . . . caatttggtaaaggctccatcatgtaataa1921439In stock
BBa_J22126Rec A (SOS) promoter . . . gagaaacaatttggtaaaggctccatcatg1861263Not in stock
BBa_J31013pLac Backwards [cf. BBa_R0010] . . . aacgcgcggggagaggcggtttgcgtattg2001364Not in stock
BBa_J34800Promoter tetracyclin inducible . . . cagtgatagagatactgagcacatcagcac941154Not in stock
BBa_J34806promoter lac induced . . . ttatgcttccggctcgtataatgtttcaaa1121197Not in stock
BBa_J34809promoter lac induced . . . ggctcgtatgttgtgtcgaccgagctgcgc1251202Not in stock
BBa_J54016promoter_lacq . . . aaacctttcgcggtatggcatgatagcgcc541188Not in stock
BBa_J54120EmrR_regulated promoter . . . atttgtcactgtcgttactatatcggctgc461204Not in stock
BBa_J54130BetI_regulated promoter . . . gtccaatcaataaccgctttaatagataaa461203Not in stock
BBa_J56012Invertible sequence of dna includes Ptrc promoter . . . actttattatcaataagttaaatcggtacc4091339Not in stock
BBa_J64065cI repressed promoter . . . gtgttgactattttacctctggcggtgata741530Not in stock
BBa_J64067LuxR+3OC6HSL independent R0065 . . . gtgttgactattttacctctggcggtgata981810Not in stock
BBa_J64068increased strength R0051 . . . atacctctggcggtgatatataatggttgc491442Not in stock
BBa_J64069R0065 with lux box deleted . . . gtgttgactattttacctctggcggtgata841383Not in stock
BBa_J64712LasR/LasI Inducible & RHLR/RHLI repressible Promoter . . . gaaatctggcagtttttggtacacgaaagc1571866Not in stock
BBa_J64800RHLR/RHLI Inducible & LasR/LasI repressible Promoter . . . tgccagttctggcaggtctaaaaagtgttc531631Not in stock
BBa_J64981OmpR-P strong binding, regulatory region for Team Challenge03-2007 . . . agcgctcacaatttaatacgactcactata821868Not in stock
BBa_J64987LacI Consensus Binding Site in sigma 70 binding region . . . taataattgtgagcgctcacaattttgaca321154Not in stock
BBa_J72005{Ptet} promoter in BBb . . . atccctatcagtgatagagatactgagcac541802In stock
BBa_K086017unmodified Lutz-Bujard LacO promoter . . . ttgtgagcggataacaagatactgagcaca551209In stock
BBa_K091100pLac_lux hybrid promoter . . . ggaattgtgagcggataacaatttcacaca744885In stock
BBa_K091101pTet_Lac hybrid promoter . . . ggaattgtgagcggataacaatttcacaca832516It's complicated
BBa_K091104pLac/Mnt Hybrid Promoter . . . ggaattgtgagcggataacaatttcacaca871938It's complicated
BBa_K091105pTet/Mnt Hybrid Promoter . . . agaactgtaatccctatcagtgatagagat981238It's complicated
BBa_K091106LsrA/cI hybrid promoter . . . tgttgatttatctaacaccgtgcgtgttga1412013It's complicated
BBa_K091107pLux/cI Hybrid Promoter . . . acaccgtgcgtgttgatatagtcgaataaa574524It's complicated
BBa_K091110LacI Promoter . . . cctttcgcggtatggcatgatagcgcccgg561299It's complicated
BBa_K091111LacIQ promoter . . . cctttcgcggtatggcatgatagcgcccgg561435It's complicated
BBa_K091112pLacIQ1 promoter . . . cctttcgcggtatggcatgatagcgcccgg563059It's complicated
BBa_K091143pLas/cI Hybrid Promoter . . . ggttctttttggtacctctggcggtgataa1641530It's complicated
BBa_K091146pLas/Lux Hybrid Promoter . . . tgtaggatcgtacaggtataaattcttcag1264661In stock
BBa_K091157pLux/Las Hybrid Promoter . . . ctatctcatttgctagtatagtcgaataaa552254Not in stock
BBa_K093000pRecA with LexA binding site . . . gtatatatatacagtataattgcttcaaca482580It's complicated
BBa_K093008reverse BBa_R0011 . . . cacaatgtcaattgttatccgctcacaatt551227Not in stock
BBa_K094120pLacI/ara-1 . . . aattgtgagcggataacaatttcacacaga1031330It's complicated
BBa_K094140pLacIq . . . ccggaagagagtcaattcagggtggtgaat801326Not in stock
BBa_K101000Dual-Repressed Promoter for p22 mnt and TetR . . . acggtgacctagatctccgatactgagcac612039Not in stock
BBa_K101001Dual-Repressed Promoter for LacI and LambdacI . . . tggaattgtgagcggataaaatttcacaca1161807Not in stock
BBa_K101002Dual-Repressed Promoter for p22 cII and TetR . . . tagtagataatttaagtgttctttaatttc661947Not in stock
BBa_K101017MioC Promoter (DNAa-Repressed Promoter) . . . ccaacgcgttcacagcgtacaattactagt3192004It's complicated
BBa_K109200AraC and TetR promoter (hybrid) . . . aacaaaaaaacggatcctctagttgcggcc1321535It's complicated
BBa_K112118rrnB P1 promoter . . . ataaatgcttgactctgtagcgggaaggcg5032103In stock
BBa_K112318{< bolA promoter>} in BBb format . . . atttcatgatgatacgtgagcggatagaag4362044It's complicated
BBa_K112401Promoter for recA gene - SOS and Ultrasound Sensitive . . . caaacagaaagcgttggcggcagcactggg2864420It's complicated
BBa_K112402promoter for FabA gene - Membrane Damage and Ultrasound Senstitive . . . gtcaaaatgaccgaaacgggtggtaacttc2564451It's complicated
BBa_K112405Promoter for CadA and CadB genes . . . agtaatcttatcgccagtttggtctggtca3704281It's complicated
BBa_K112406cadC promoter . . . agtaatcttatcgccagtttggtctggtca23471785It's complicated
BBa_K112701hns promoter . . . aattctgaacaacatccgtactcttcgtgc6692559Not in stock
BBa_K112708PfhuA . . . tttacgttatcattcactttacatcagagt2101858Not in stock
BBa_K113009pBad/araC . . . gtttctccatacccgtttttttgggctagc12101793In stock
BBa_K116001nhaA promoter, that can be regulated by pH and nhaR protein. . . . cgatctattcacctgaaagagaaataaaaa2745780It's complicated
BBa_K116500OmpF promoter that is activated or repressesed by OmpR according to osmolarity. . . . aaacgttagtttgaatggaaagatgcctgc1261250It's complicated
BBa_K119002RcnR operator (represses RcnA) . . . attgccgaattaatactaagaattattatc831387It's complicated
BBa_K121011promoter (lacI regulated) . . . acaggaaacagctatgaccatgattacgcc2321333Not in stock
BBa_K121014promoter (lambda cI regulated) . . . actggcggttataatgagcacatcagcagg901400Not in stock
BBa_K137046150 bp inverted tetR promoter . . . caccgacaaacaacagataaaacgaaaggc1501739It's complicated
BBa_K137047250 bp inverted tetR promoter . . . agtgttattaagctactaaagcgtagtttt2501740It's complicated
BBa_K137048350 bp inverted tetR promoter . . . gaataagaaggctggctctgcaccttggtg3501741It's complicated
BBa_K137049450 bp inverted tetR promoter . . . ttagcgacttgatgctcttgatcttccaat4501741It's complicated
BBa_K137050650 bp inverted tetR promoter . . . acatctaaaacttttagcgttattacgtaa6501741It's complicated
BBa_K137051850 bp inverted tetR promoter . . . ttccgacctcattaagcagctctaatgcgc8501740It's complicated
BBa_K137125LacI-repressed promoter B4 . . . caatttttaaaattaaaggcgttacccaac1031347It's complicated
BBa_K145150Hybrid promoter: HSL-LuxR activated, P22 C2 repressed . . . tagtttataatttaagtgttctttaatttc662130It's complicated
BBa_K145152Hybrid promoter: P22 c2 , LacI NOR gate . . . gaaaatgtgagcgagtaacaacctcacaca1421431Not in stock
BBa_K1520005Plac-rbs-rfp-Ter . . . caccttcgggtgggcctttctgcgtttata10771495It's complicated
BBa_K1520014Ptet-rbs-rfp-Ter . . . caccttcgggtgggcctttctgcgtttata9311467It's complicated
BBa_K1520025Ptet-rbs-rfp-Ter-Plac-rbs-tetR-Ter . . . caccttcgggtgggcctttctgcgtttata19871290Not in stock
BBa_K1520026Ptet-rbs-rfp-Ter-Plac-rbs-tetR-Ter-Pcons2-rbs-lacI-Ter . . . caccttcgggtgggcctttctgcgtttata33461309Not in stock
BBa_K1520509PgolTS-golS-PgolB-rbs-tetR-Ter-PtetO-rbs-rfp-Ter-Plac-rbs-tetR-Ter-Pcons2-rbs-lacI-Ter . . . caccttcgggtgggcctttctgcgtttata49552083Not in stock
BBa_K1682002PkdpF[-15, T>A] . . . tctttgcagccagaaatctacccttccggt789539It's complicated
BBa_K1682003PkdpF[-15, T>C] . . . tctttgcagccagaactctacccttccggt789541It's complicated
BBa_K1682004PkdpF[-15, T>G] . . . tctttgcagccagaagtctacccttccggt7811751In stock
BBa_K1682012PphoA promoter . . . gctttgtttttattttttaatgtatttgta853467It's complicated
BBa_K1824895Ptet + RBS . . . gcactactagagaaagaggagaaatactag801348It's complicated
BBa_K1886017broken_Ptet . . . tactgagcacatcagcaggacgcactgacc491947Not in stock
BBa_K256028placI:CHE . . . caccttcgggtgggcctttctgcgtttata13053383Not in stock
BBa_K259005AraC Rheostat Promoter . . . ttttatcgcaactctctactgtttctccat3401934It's complicated
BBa_K259007AraC Promoter fused with RBS . . . gtttctccattactagagaaagaggggaca3606988It's complicated
BBa_K266001Inverter TetR -> LuxR . . . caccttcgggtgggcctttctgcgtttata18901766It's complicated
BBa_K266003POPS -> Lac Inverter -> LasR . . . caccttcgggtgggcctttctgcgtttata23151392It's complicated
BBa_K266004Const Lac Inverter -> LasR . . . caccttcgggtgggcctttctgcgtttata23581418It's complicated
BBa_K266005PAI+LasR -> LasI & AI+LuxR --| LasI . . . aataactctgatagtgctagtgtagatctc8191498It's complicated
BBa_K266006PAI+LasR -> LasI+GFP & AI+LuxR --| LasI+GFP . . . caccttcgggtgggcctttctgcgtttata17051471It's complicated
BBa_K266007Complex QS -> LuxI & LasI circuit . . . caccttcgggtgggcctttctgcgtttata26761513It's complicated
BBa_K266008J23100 + Lac inverter . . . ttgtgagcggataacaagatactgagcaca14141444It's complicated
BBa_K266009J23100 + Lac inverter + RBS . . . actgagcacatactagagaaagaggagaaa14341310It's complicated
BBa_K266011Lac Inverter and strong RBS . . . actgagcacatactagagaaagaggagaaa13911291Not in stock
BBa_K292002pLac (LacI regulated) + Strong RBS . . . tcacacatactagagattaaagaggagaaa2232924In stock
BBa_K3040501Lipase-Pseudomonas sp 7323. . . . atgactcagcgcacgctaacgcgacagttc22279863Not in stock
BBa_K873002HSP promoter . . . ggcgaagcctcatccccatttctctggtca474496In stock
BBa_M31370tacI Promoter . . . ggaattgtgagcggataacaatttcacaca681406Not in stock
BBa_R0010promoter (lacI regulated) . . . ggaattgtgagcggataacaatttcacaca20046722In stock
BBa_R0011Promoter (lacI regulated, lambda pL hybrid) . . . ttgtgagcggataacaagatactgagcaca5523492In stock
BBa_R0040TetR repressible promoter . . . atccctatcagtgatagagatactgagcac5425578In stock
BBa_R0050Promoter (HK022 cI regulated) . . . ccgtcataatatgaaccataagttcaccac552361It's complicated
BBa_R0051promoter (lambda cI regulated) . . . tattttacctctggcggtgataatggttgc499224In stock
BBa_R0052Promoter (434 cI regulated) . . . attgtatgaaaatacaagaaagtttgttga462587In stock
BBa_R0053Promoter (p22 cII regulated) . . . tagtagataatttaagtgttctttaatttc542610In stock
BBa_R0061Promoter (HSL-mediated luxR repressor)ttgacacctgtaggatcgtacaggtataat309023In stock
BBa_R0063Promoter (luxR & HSL regulated -- lux pL)
. . . cacgcaaaacttgcgacaaacaataggtaa1514614In stock
BBa_R0065Promoter (lambda cI and luxR regulated -- hybrid) . . . gtgttgactattttacctctggcggtgata973065In stock
BBa_R0073Promoter (Mnt regulated) . . . tagatctcctatagtgagtcgtattaattt672760In stock
BBa_R0074Promoter (PenI regulated) . . . tactttcaaagactacatttgtaagatttg772872In stock
BBa_R0075Promoter (TP901 cI regulated) . . . cataaagttcatgaaacgtgaactgaaatt1171455It's complicated
BBa_R1050Promoter, Standard (HK022 cI regulated)
. . . ccgtgatactatgaaccataagttcaccac562482In stock
BBa_R1051Promoter, Standard (lambda cI regulated)
. . . aattttacctctggcggtgatactggttgc493091In stock
BBa_R1052Promoter, Standard (434 cI regulated)
. . . attgtatgatactacaagaaagtttgttga461981It's complicated
BBa_R1053Promoter, Standard (p22 cII regulated)
. . . tagtagatactttaagtgttctttaatttc552014It's complicated
BBa_R2000Promoter, Zif23 regulated, test: between . . . tggtcccacgcgcgtgggatactacgtcag451824In stock
BBa_R2001Promoter, Zif23 regulated, test: after . . . attacggtgagatactcccacgcgcgtggg521886In stock
BBa_R2002Promoter, Zif23 regulated, test: between and after . . . acgcgcgtgggatactcccacgcgcgtggg521948In stock
BBa_R2108Promoter with operator site for C2003 . . . gattagattcataaatttgagagaggagtt721357Not in stock
BBa_R2109Promoter with operator site for C2003 . . . acttagattcataaatttgagagaggagtt721350In stock
BBa_R2110Promoter with operator site for C2003 . . . ggttagattcataaatttgagagaggagtt721347Not in stock
BBa_R2111Promoter with operator site for C2003 . . . acttagattcataaatttgagagaggagtt721342Not in stock
BBa_R2112Promoter with operator site for C2003 . . . aattagattcataaatttgagagaggagtt721347Not in stock
BBa_R2113Promoter with operator site for C2003 . . . acttagattcataaatttgagagaggagtt721347Not in stock
BBa_R2114Promoter with operator site for C2003 . . . atttagattcataaatttgagagaggagtt721444It's complicated
BBa_R2201C2006-repressible promoter . . . cacgcgcgtgggaatgttataatacgtcag451533Not in stock
BBa_S03385Cold-sensing promoter (hybB)  1759No part sequence
BBa_S04209R0051:Q04121:B0034:C0079:B0015 . . . actgagcacatactagagaaagaggagaaa14341169It's complicated

Negatively regulated E. coli σS promoters

This section lists promoters that are recognized by E. coli σS RNAP. σS is the major stationary phase E. coli sigma factor. Use these promoters when you want high promoter activity during stationary phase or during starvation. Since σS promoters have the same consensus promoter sequence as σ70 promoters, you may find these promoters will be weakly expressed by σ70 RNAP.


More...
NameDescriptionPromoter SequencePositive
Regulators
Negative
Regulators
LengthDocStatus
BBa_K086030modified Lutz-Bujard LacO promoter,with alternative sigma factor σ38 . . . cagtgagcgagtaacaactacgctgtttta551294Not in stock
BBa_K086031modified Lutz-Bujard LacO promoter,with alternative sigma factor σ38 . . . cagtgagcgagtaacaactacgctgtttta551296Not in stock
BBa_K086032modified Lutz-Bujard LacO promoter,with alternative sigma factor σ38 . . . atgtgagcggataacactataattaataga551294Not in stock
BBa_K086033modified Lutz-Bujard LacO promoter,with alternative sigma factor σ38 . . . atgtgagcggataacactataattaataga551294Not in stock
BBa_K112318{< bolA promoter>} in BBb format . . . atttcatgatgatacgtgagcggatagaag4362044It's complicated

Negatively regulated E. coli σ32 promoters

This section lists promoters that are recognized by E. coli σ32 RNAP. σ32 is the major heat shock sigma factor in E. coli. Use these promoters when you want high promoter activity during heat shock. These promoters are also active under several different shock responses.


More...
NameDescriptionPromoter SequencePositive
Regulators
Negative
Regulators
LengthDocStatus
BBa_K086026modified Lutz-Bujard LacO promoter,with alternative sigma factor σ32 . . . ttgtgagcgagtggcaccattaagtacgta551294Not in stock
BBa_K086027modified Lutz-Bujard LacO promoter,with alternative sigma factor σ32 . . . ttgtgagcgagtgacaccattaagtacgta551294Not in stock
BBa_K086028modified Lutz-Bujard LacO promoter,with alternative sigma factor σ32 . . . ttgtgagcgagtaacaccattaagtacgta551294Not in stock
BBa_K086029modified Lutz-Bujard LacO promoter,with alternative sigma factor σ32 . . . ttgtgagcgagtaacaccattaagtacgta551294Not in stock

Negatively regulated E. coli σ54 promoters

This section lists promoters that are recognized by E. coli σ54 RNAP. σ54 is a minor E. coli sigma factor that is most highly expressed during nitrogen-limitation. Use these promoters if you want promoter activity to depend on ammonia or nitrogen levels. Alternatively, since this is a minor sigma factor that recognizes promoters with a very different sequence to σ70 promoters, this sigma factor could be repurposed to be be expressed and active during some user-chosen set of environmental conditions, essentially producing a user controllable RNAP.


More...
NameDescriptionPromoter SequencePositive
Regulators
Negative
Regulators
LengthDocStatus
BBa_J64979glnAp2 . . . agttggcacagatttcgctttatctttttt1511249Not in stock


NegativePromoter.png

The promoters here are B. subtilis promoters that are negatively regulated meaning that increased levels of at least one transcription factor (other than the sigma factor) will decrease the activity of these promoters.

Negatively regulated B. subtilis promoters

Repressible B. subtilis σA promoters

This section lists promoters that are recognized by B. subtilis σA RNAP. σA is the major B. subtilis sigma factor so there should be RNAP present to transcribe these promoters under most growth conditions (although maximally during exponential growth).


More...
NameDescriptionPromoter SequencePositive
Regulators
Negative
Regulators
LengthDocStatus
BBa_K090501Gram-Positive IPTG-Inducible Promoter . . . tggaattgtgagcggataacaattaagctt1072054It's complicated
BBa_K143014Promoter Xyl for B.subtilis . . . agtttgtttaaacaacaaactaataggtga822112Not in stock
BBa_K143015Promoter hyper-spank for B. subtilis . . . aatgtgtgtaattgtgagcggataacaatt1012527Not in stock

Repressible B. subtilis σB promoters

This section lists promoters that are recognized by B. subtilis σB RNAP. σB is the major stationary phase E. coli sigma factor. Use these promoters when you want high promoter activity during stationary phase or during starvation.


There are no parts for this table