Difference between revisions of "DNA/Recombination"
(5 intermediate revisions by the same user not shown) | |||
Line 1: | Line 1: | ||
[[DNA|< Back to DNA parts]] | [[DNA|< Back to DNA parts]] | ||
− | {{: | + | <html> |
+ | <style> | ||
+ | #assembly_plasmid_table {margin-left:auto;margin-right:auto; border: 3px solid #444444;} | ||
+ | #assembly_plasmid_table td {background-color:#eeeeee; padding: 5px; font-size: 12px;} | ||
+ | #assembly_plasmid_table th {background-color: #aaaaaa;padding: 5px; font-size:14px;} | ||
+ | </style> | ||
+ | </html> | ||
− | + | Recombination sites are DNA sequences at which recombination events take place. | |
− | + | For details on the different recombination systems available via the Registry as well as how they work, see [[Recombination]]. | |
− | + | ||
− | + | <parttable>recombination_site_DNA</parttable> | |
− | + | ||
− | + | <!-- To include a part in this table, include the categories "//DNA/recombinationsite" under the Hard Information tab of the part. --> | |
− | + | ||
− | + | ||
__NOTOC__ | __NOTOC__ |
Latest revision as of 22:38, 20 April 2009
Recombination sites are DNA sequences at which recombination events take place.
For details on the different recombination systems available via the Registry as well as how they work, see Recombination.
Name | Description | Sequence | Length |
---|---|---|---|
BBa_I11022 | Lambda attB, reverse complement | accactttgtacaagaaagctgggt | 25 |
BBa_I11023 | Lambda attP | . . . tcactatcagtcaaaataaaatcattattt | 232 |
BBa_I11032 | P22 ''attB'', reverse complement | acgaccttcgcattacgaatgcgctgc | 27 |
BBa_I11033 | P22 ''attP'' | . . . gggacatatttgggacagaagtaccaaaaa | 260 |
BBa_I718016 | lox66 | . . . cttggtatagcatacattatacgaacggta | 34 |
BBa_I718017 | lox71 | . . . gttcgtatacgatacattatacgaagttat | 34 |
BBa_I742101 | dif site with forward orientation | . . . tcggtgcgcataatgtatattatgttaaat | 31 |
BBa_I742102 | dif site with reverse orientation | . . . tcatttaacataatatacattatgcgcacc | 31 |
BBa_J3101 | Recombinational Enhancer (RE) for Hin/Hix inverting | . . . ctttctagtgcaaattgtgaccgcattttg | 77 |
BBa_J44000 | hixC binding site for Salmonella typhimurium Hin recombinase | ttatcaaaaaccatggtttttgataa | 26 |
BBa_J61020 | [FRT] | . . . ttcctatactttttagagaataggaacttc | 34 |
BBa_J61046 | [Lox] site for recombination | . . . cttcgtataatgtatgctatacgaagttat | 34 |
BBa_J72001 | {FRT} recombination site for flp recombinase in BBb | . . . ttcctatactttctagagaataggaacttc | 36 |
BBa_K112141 | attR2 recombination site | . . . gttcagctttcttgtacaaagtggttgatc | 136 |
BBa_K112142 | attR2 recombination site-reverse orientation | . . . aacacaacatatccagtcactatggtcgac | 136 |
BBa_K137008 | fimE IRR | . . . gaaacatttggggccaaactgtccatatta | 35 |
BBa_K137010 | fimE IRL | . . . gagtcaaaatggccccaattgtcttgtatt | 35 |
BBa_K1680005 | loxP Site | . . . cttcgtatagcatacattatacgaagttat | 34 |
BBa_K315011 | Variant reverse lox N | . . . cttcgtatagtataccttatacgaagttat | 34 |
BBa_K3697003 | Homology Arms for KanR integration in B. Subtilis | . . . gcttgcaaacaaaaaaaccaccgctaccag | 1103 |
BBa_K416002 | 36 Base Pair LoxP | . . . tcgtataatgtatgctatacgaagttatcg | 36 |
BBa_K5276011 | TP901B-TC | . . . atcaaggtaaatgctttttgctttttttgc | 53 |
BBa_K5276012 | TP901P-TC | . . . ttaattgaaataaacgaaataaaaactcgc | 50 |
BBa_K863201 | 3' UTR site of alcohol oxidase 1 gene (aox1) | . . . tcatcaacttgaggggcactatcttgtttt | 676 |
BBa_K886000 | Fixed lox71 | . . . gttcgtatagcatacattatacgaagttat | 34 |