Difference between revisions of "DNA/Recombination"

 
(7 intermediate revisions by the same user not shown)
Line 1: Line 1:
 
[[DNA|< Back to DNA parts]]
 
[[DNA|< Back to DNA parts]]
  
{{:DNA/Recombination/Overview}}
+
<html>
 +
<style>
 +
#assembly_plasmid_table {margin-left:auto;margin-right:auto; border: 3px solid #444444;}
 +
#assembly_plasmid_table td {background-color:#eeeeee; padding: 5px; font-size: 12px;}
 +
#assembly_plasmid_table th {background-color: #aaaaaa;padding: 5px; font-size:14px;}
 +
</style>
 +
</html>
  
Site-specific recombination systems derived from ''Salmonella'', different bacteriophages, yeast, and ''E. coli'' are all available from the Registry.  For more details on individual DNA recombination systems, click the links below.
+
Recombination sites are DNA sequences at which recombination events take place.
  
*[[DNA/Recombination/Salmonella typhimurium-derived Hin-hix|'''''Salmonella typhimurium''-derived Hin/''hix'' DNA recombination system''']]
+
For details on the different recombination systems available via the Registry as well as how they work, see [[Recombination]].
*[[DNA/Recombination/Bacteriophage P1-derived Cre-lox|'''Bacteriophage P1-derived Cre/''lox'' DNA recombination system''']]  
+
 
*[[DNA/Recombination/Bacteriophage lambda-derived att|'''Bacteriophage &lambda;-derived ''att'' DNA recombination system''']] 
+
<parttable>recombination_site_DNA</parttable>
*[[DNA/Recombination/Bacteriophage P22-derived att|'''Bacteriophage P22 ''att'' DNA recombination system''']]
+
 
*[[DNA/Recombination/Saccharomyces cerevisiae-derived Flp-FRT|'''Yeast Flp/''FRT'' DNA recombination system''']]
+
<!-- To include a part in this table, include the categories "//DNA/recombinationsite" under the Hard Information tab of the part. -->
*[[DNA/Recombination/Escherichia coli-derived XerCD-dif|'''''Escherichia coli'' XerCD/''dif'' DNA recombination system''']]
+
  
 
__NOTOC__
 
__NOTOC__

Latest revision as of 22:38, 20 April 2009

< Back to DNA parts

Recombination sites are DNA sequences at which recombination events take place.

For details on the different recombination systems available via the Registry as well as how they work, see Recombination.


More...
NameDescriptionSequenceLength
BBa_I11022Lambda attB, reverse complementaccactttgtacaagaaagctgggt25
BBa_I11023Lambda attP . . . tcactatcagtcaaaataaaatcattattt232
BBa_I11032P22 ''attB'', reverse complementacgaccttcgcattacgaatgcgctgc27
BBa_I11033P22 ''attP'' . . . gggacatatttgggacagaagtaccaaaaa260
BBa_I718016lox66 . . . cttggtatagcatacattatacgaacggta34
BBa_I718017lox71 . . . gttcgtatacgatacattatacgaagttat34
BBa_I742101dif site with forward orientation . . . tcggtgcgcataatgtatattatgttaaat31
BBa_I742102dif site with reverse orientation . . . tcatttaacataatatacattatgcgcacc31
BBa_J3101Recombinational Enhancer (RE) for Hin/Hix inverting . . . ctttctagtgcaaattgtgaccgcattttg77
BBa_J44000hixC binding site for Salmonella typhimurium Hin recombinasettatcaaaaaccatggtttttgataa26
BBa_J61020[FRT] . . . ttcctatactttttagagaataggaacttc34
BBa_J61046[Lox] site for recombination . . . cttcgtataatgtatgctatacgaagttat34
BBa_J72001{FRT} recombination site for flp recombinase in BBb . . . ttcctatactttctagagaataggaacttc36
BBa_K112141attR2 recombination site . . . gttcagctttcttgtacaaagtggttgatc136
BBa_K112142attR2 recombination site-reverse orientation . . . aacacaacatatccagtcactatggtcgac136
BBa_K137008fimE IRR . . . gaaacatttggggccaaactgtccatatta35
BBa_K137010fimE IRL . . . gagtcaaaatggccccaattgtcttgtatt35
BBa_K1680005loxP Site . . . cttcgtatagcatacattatacgaagttat34
BBa_K315011Variant reverse lox N . . . cttcgtatagtataccttatacgaagttat34
BBa_K3697003Homology Arms for KanR integration in B. Subtilis . . . gcttgcaaacaaaaaaaccaccgctaccag1103
BBa_K41600236 Base Pair LoxP . . . tcgtataatgtatgctatacgaagttatcg36
BBa_K5276011TP901B-TC . . . atcaaggtaaatgctttttgctttttttgc53
BBa_K5276012TP901P-TC . . . ttaattgaaataaacgaaataaaaactcgc50
BBa_K8632013' UTR site of alcohol oxidase 1 gene (aox1) . . . tcatcaacttgaggggcactatcttgtttt676
BBa_K886000Fixed lox71 . . . gttcgtatagcatacattatacgaagttat34