|
|
| (48 intermediate revisions by the same user not shown) |
| Line 9: |
Line 9: |
| | </html> | | </html> |
| | | | |
| − | ==''Salmonella typhimurium''-derived Hin/''hix'' DNA recombination system==
| + | Recombination sites are DNA sequences at which recombination events take place. |
| | | | |
| − | {|
| + | For details on the different recombination systems available via the Registry as well as how they work, see [[Recombination]]. |
| − | |[[Image:KarmellaHaynesPhoto.jpg|60px|center]]
| + | |
| − | |Karmella Haynes and the [http://parts.mit.edu/wiki/index.php/Davidson_2006 2006 Davidson College/Missouri Western iGEM team], designed and constructed a set of parts from the ''Salmonella typhimurium''-derived DNA recombination system. You can read more about the 2006 Davidson/Missouri Western project in their open-access paper [http://www.jbioleng.org/content/2/1/8 Engineering bacteria to solve the Burnt Pancake Problem] published in the ''Journal of Biological Engineering'' <cite>Haynes</cite>. The following is excerpted from their paper.
| + | |
| − | |}
| + | |
| − | | + | |
| − | In ''Salmonella'', Hin DNA recombinase ([[Part:BBa_J31000|BBa_J31000]], [[Part:BBa_J31001|BBa_J31001]]) catalyzes an inversion reaction that regulates the expression of alternative flagellin genes by switching the orientation of a promoter located on a 1 kb invertible DNA segment <cite>Zieg,Zieg80</cite>. Two palindromic 26 bp ''hix'' sequences flank the invertible DNA segment and serve as the recognition sites for cleavage and strand exchange. A ~70 bp cis-acting ''recombinational enhancer (RE)'' increases efficiency of protein-DNA complex formation ([[Part:BBa_J3101|BBa_J3101]]) <cite>Johnson</cite>. We have reconstituted the genetic elements required for DNA inversion as a collection of modular genetic elements for use in ''E. coli''. Our system is a proof-of-concept genetic computing device that manipulates plasmid DNA processors within living cells.
| + | |
| − | | + | |
| − | In ''Salmonella'', the asymmetrical palindromic sequences ''hixL'' and ''hixR'' flank the invertible DNA segment and serve as the recognition sites for cleavage and strand exchange. Our system uses ''hixC'' ([[Part:BBa_J44000|BBa_J44000]]), a composite symmetrical hix site that shows higher binding affinity for Hin and a 16-fold slower inversion rate than wild type sites ''hixL'' and ''hixR'' <cite>Lim,Moskowitz</cite>.
| + | |
| − | | + | |
| − | We have demonstrated that a modified Hin/''hix'' DNA recombination system can be used ''in vivo'' to manipulate at least two adjacent ''hixC''-flanked DNA segments; HinLVA and ''hixC'' are sufficient for DNA inversion activity. The Hin/''hix'' DNA recombination system could be used for other biological engineering applications. We have developed a set of modular genetic elements, ''hixC'' ([[Part:BBa_J44000|BBa_J44000]]), ''RE'' ([[Part:BBa_J3101|BBa_J3101]]), and ''HinLVA'' ([[Part:BBa_J31001|BBa_J31001]]), that expands the repertoire of molecular tools for enzyme-mediated DNA manipulation ''in vivo''.
| + | |
| − | | + | |
| − | <parttable>hix_recombination_site_DNA</parttable>
| + | |
| − | | + | |
| − | <!-- To include a part in this table, include the categories "//DNA/recombinationsite/hix" under the Hard Information tab of the part. -->
| + | |
| − | | + | |
| − | ===References===
| + | |
| − | <biblio>
| + | |
| − | #Zieg pmid=322276
| + | |
| − | #Zieg80 pmid=6933466
| + | |
| − | #Johnson pmid=2548848
| + | |
| − | #Haykinson pmid=8508775
| + | |
| − | #PerkinsBalding pmid=9244261
| + | |
| − | #Haynes pmid=18492232
| + | |
| − | #Ham pmid=18665232
| + | |
| − | #Nanassy pmid=9691026
| + | |
| − | #Moswitz pmid=1885005
| + | |
| − | #Lim pmid=1597453
| + | |
| − | </biblio>
| + | |
| − | | + | |
| − | | + | |
| − | ==Bacteriophage P1 Cre/''lox'' DNA recombination system==
| + | |
| − | {|
| + | |
| − | |[[Image:JCA Photo.png|50px|center]]
| + | |
| − | |Chris Anderson, a professor of bioengineering at UC Berkeley, constructed the lox recombination site [[Part:BBa_J61046|BBa_J61046]].
| + | |
| − | |[[Image:NoPhotoAvailable.jpg|60px|center]]
| + | |
| − | |Eimad Shotar, a member of the [http://parts.mit.edu/igem07/index.php/Paris 2007 Paris iGEM team], constructed the lox recombination sites [[Part:BBa_I718016|BBa_I718016]] and [[Part:BBa_I718017|BBa_I718017]].
| + | |
| − | |}
| + | |
| − | | + | |
| − | | + | |
| − | ''The following text is excerpted from Siegel ''et al.'' <cite>Siegel04</cite>.''
| + | |
| − | | + | |
| − | Bacteriophage P1 uses a site-specific recombination system that is responsible for partitioning newly synthesized genomic copies during replication <cite>Abremski, Hoess</cite>. This system is composed of a 38-kD phage-encoded Cre recombinase that mediates symmetrical recombination between two 34-bp ''loxP'' sites <cite>Abremski</cite>, which are recreated after recombination. Recombination between two compatible ''loxP'' sites will excise or invert the intervening DNA in the case of an intramolecular reaction or transfer suitably flanked ''loxP'' DNA in an intermolecular double cross-over recombination event. The Cre/''loxP'' system does not require accessory factors to carry out recombination ''in vivo'' or ''in vitro'', and studies have identified several hetero-specific ''loxP'' sequences that exclusively recombine with themselves, but not with wild-type ''lox'' <cite>Hoess86, Sauer92, Lee98, Siegel01</cite>. Importantly, the Cre/''lox'' system has also been shown to be functional in site-specific recombination in mammalian cell lines <cite>Sauer88</cite>.
| + | |
| − | | + | |
| − | <parttable>lox_recombination_site_DNA</parttable>
| + | |
| − | | + | |
| − | <!-- To include a part in this table, include the categories "//DNA/recombinationsite/lox" under the Hard Information tab of the part. -->
| + | |
| − | | + | |
| − | ===References===
| + | |
| − | <biblio>
| + | |
| − | #Abremski pmid=6319400
| + | |
| − | #Hoess pmid=6230671
| + | |
| − | #Hamilton pmid=6333513
| + | |
| − | #Hoess86 pmid=3457367
| + | |
| − | #Sauer88 pmid=2839833
| + | |
| − | #Sauer92 pmid=1554399
| + | |
| − | #Lee98 pmid=9714735
| + | |
| − | #Sauer98 pmid=9608509
| + | |
| − | #Siegel01 pmid=11576551
| + | |
| − | #Sauer02 pmid=12624421
| + | |
| − | #Siegel04 pmid=15173117
| + | |
| − | </biblio>
| + | |
| − | | + | |
| − | | + | |
| − | ==Bacteriophage λ /''att'' DNA recombination system==
| + | |
| − | | + | |
| − | ''The following is excerpted from Radman-Livaja et al. <cite>RadmanLivaja</cite> and Landy et al. <cite>Landy</cite>. It has been edited for clarity.''
| + | |
| − | | + | |
| − | Bacteriophage λ has long served as a model system for studies of regulated site-specific recombination. In conditions favorable for bacterial growth, the phage genome is inserted into the ''Escherichia coli'' genome by an ‘integrative’ recombination reaction, which takes place between DNA attachment sites called ''attP'' and ''attB'' in the phage and bacterial genomes, respectively. As a result, the integrated λ DNA is bounded by hybrid attachment sites, termed ''attL'' and ''attR''. In response to the physiological state of the bacterial host or to DNA damage, λ phage DNA excises itself from the host chromosome. This excision reaction recombines attL with attR to precisely restore the ''attP'' and ''attB'' sites on the circular λ and E. coli DNAs <cite>Campbell</cite>. The product of the phage gene ''int'' is required for both integration and excision of the λ prophage <cite>Zissler67</cite>.
| + | |
| − | | + | |
| − | The phage-encoded λ integrase protein (Int) splices together bacterial and phage attachment sites by a mechanism that is common to a large family of tyrosine recombinases with diverse biological functions (for reviews, see <cite>Hallett97, Azaro02</cite>). Recombination initiates with the pairing of two specific DNA segments by a tetramer of recombinase molecules. A four-way DNA junction (Holliday junction) is formed by the cleavage, exchange and ligation of one pair of strands, and is resolved to helical DNA products by the exchange of the second pair of strands [4–7]. The DNA cleavage activity is strictly regulated within the tetramer, with only one pair of molecules active at a time. This control ensures the ordered pairwise exchange of DNA strands and avoids potentially harmful double-strand breaks.
| + | |
| − | | + | |
| − | λ recombination has a strong directional bias in response to environmental conditions. Accessory factors, whose expression levels change in response to host physiology, control the action of Int and determine whether the phage genome will remain integrated or be excised. Int has two DNA-binding domains: a C-terminal domain, consisting of a catalytic domain and a core-binding (CB) domain, that interacts with the core recombining sites and an N-terminal domain (N-domain) that recognizes the regulatory arm DNA sites <cite>Wojciak02</cite>. The heterobivalent Int molecules bridge distant core and arm sites with the help of accessory proteins, such as integration host factor (IHF), which bend the DNA at intervening sites, and appose arm and core sequences for interaction with the Int recombinase. Five arm DNA sites in the regions flanking the core of ''attP'' are differentially occupied during integration and excision reactions. The integration products ''attL'' and ''attR'' cannot revert back to ''attP'' and ''attB'' without assistance from the phage-encoded factor Xis, which bends DNA on its own or in combination with the host-encoded factor Fis [12–17]. Xis also inhibits integration, and prevents the ''attP'' and ''attB'' products of excision from reverting to ''attL'' and ''attR'' [13,18]. Excision is inhibited by high concentrations of IHF [19,20]. Because the cellular levels of IHF and Fis proteins respond to growth conditions, these host-encoded factors have been proposed as the master signals for integration and excision [15,19–23].
| + | |
| − | | + | |
| − | ''The following is excerpted from Landy et al. <cite>Landy</cite>. It has been edited for clarity.''
| + | |
| − | | + | |
| − | The phage (''attP'') and bacterial (''attB'') ''att'' sites are designated POP’ and BOB’, respectively, and the prophage ''att'' sites are designated BOP’ (''attL'') and POB’ (''attR''). Transducing phage carrying ''attL'' (λ''gal'') or ''attR'' (λ''bio'') are generated from a prophage which has excised from the host chromosome by a rare ''int''-independent recombination which deletes phage DNA from one end of the prophage and adds bacterial DNA to the other <cite>Campbell</cite>. A phage carrying the bacterial ''att'' site, BOB’, is obtained as a product of ''int''-promoted recombination between a ''gal'' (BOP’) and a ''bio'' (POB’) transducing phage which is capable of transducing gal and bio together <cite>Echols70</cite>.
| + | |
| − | | + | |
| − | When ''Escherichia coli'' carries a deletion of the primary bacterial ''att'' site BOB’, ''int''-dependent integration of λ can be detected at numerous loci (secondary bacterial ''att'' sites) on the ''E. coli'' chromosome <cite>Shimada72</cite>. This integration always involves the phage att site (POP’) <cite>Shimada75</cite> and is thus very similar to the behavior of IS-elements <cite>Fiandt72, Hirsch72</cite>. The secondary prophage att sites are given the general designation ΔOP’ and POΔ’ and they differ from BOP’ and POB’ and from each other in their biological properties as determined by ''int''- and ''xis'' -dependent recombination frequencies with various ''att'' sites.
| + | |
| − | | + | |
| − | ===References===
| + | |
| − | <biblio>
| + | |
| − | #Campbell Campbell, AM. Episomes. In: Caspari EW, Thoday JM. , editors. Advances in Genetics. 1. New York: Academic Press; 1962. pp. 101–145.
| + | |
| − | #Zissler67 pmid=5637199
| + | |
| − | #Guameros70 pmid=4907272
| + | |
| − | #Kaiser70 pmid=4907271
| + | |
| − | #Echols70 pmid=4907273
| + | |
| − | #Shimada72 pmid=4552408
| + | |
| − | #Shimada75 pmid=1095763
| + | |
| − | #Fiandt72 pmid=4567155
| + | |
| − | #Hirsch72 pmid=4567154
| + | |
| − | #Hallett97 pmid=9348666
| + | |
| − | #Azaro02 Azaro, MA; Landy, A. λ Int and the λ Int family. In: Craig NL, Craigie R, Gellert M, Lambowitz A. , editors. Mobile DNA II. Washington, DC: ASM Press; 2002. pp. 118–148.
| + | |
| − | #Wojciak02 pmid=11904406
| + | |
| − | #Landy pmid=331474
| + | |
| − | #Landy89 pmid=2528323
| + | |
| − | #RadmanLivaja pmid=16368232
| + | |
| − | </biblio>
| + | |
| − | | + | |
| − | ==''E. coli'' XerCD/''dif'' DNA recombination system==
| + | |
| − | | + | |
| − | {|
| + | |
| − | | [[Image:XiaonanWangPhoto.jpg|100px]]
| + | |
| − | | Xiaonan Wang, a member of the [http://parts.mit.edu/igem07/index.php/Edinburgh 2007 University of Edinburgh iGEM team], designed the ''dif'' recombination sites [[Part:BBa_I742101|BBa_I742101]] and [[Part:BBa_I742102|BBa_I742102]].
| + | |
| − | |}
| + | |
| − | | + | |
| − | ''The following text is excerpted from Ip et al. <cite>Ip03</cite>.''
| + | |
| − | | + | |
| − | The separation and segregation of newly replicated [''E. coli''] circular chromosomes can also be prevented by the formation of circular chromosome dimers, which can arise during crossing over by homologous recombination <cite>Blakely91; Clerget91; Kuempel91</cite>. In ''E. coli'', these dimers, which arise about once every six generations, are resolved to monomers by the action of the FtsK–XerCD–dif chromosome dimer resolution machinery <cite>Steiner98a, Steiner98b, Recchia99, Steiner99</cite>. Two site-specific recombinases of the tyrosine recombinase family, XerCD, act at a 28 bp recombination site, ''dif'', located in the replication terminus region of the ''E. coli'' chromosome to remove the crossover introduced by dimer formation, thereby converting dimers to monomers. A complete dimer resolution reaction during recombination at dif requires the action of the C-terminal domain of FtsK (FtsK<sub>C</sub>) <cite>Steiner99; Barre00</cite>. FtsK is a multifunctional protein whose N-terminal domain acts in cell division, while the C-terminal domain functions in chromosome segregation <cite>Liu98; Wang98; Yu98a, Yu98b</cite>. Therefore, FtsK is well suited to coordinate chromosome segregation and cell division. A purified protein, FtsK<sub>50C</sub>, containing a functional C-terminal domain, can translocate DNA in an ATP-dependent manner and activate Xer recombination at the recombination site ''dif'', thereby reconstituting ''in vitro'' the expected ''in vivo'' activities of the C-terminal domain of the complete FtsK protein <cite>Aussel02</cite>.
| + | |
| − | | + | |
| − | <parttable>dif_recombination_site_DNA</parttable>
| + | |
| − | | + | |
| − | <!-- To include a part in this table, include the categories "//DNA/recombinationsite/dif" under the Hard Information tab of the part. -->
| + | |
| − | | + | |
| − | ===References===
| + | |
| − | <biblio>
| + | |
| − | #Blakely91 pmid=1931824
| + | |
| − | #Clerget91 pmid=1931823
| + | |
| − | #Kuempel91 pmid=1657123
| + | |
| − | #Steiner98a pmid=9484882
| + | |
| − | #Steiner98b pmid=9829936
| + | |
| − | #Liu98 pmid=9723927
| + | |
| − | #Wang98 pmid=9723913
| + | |
| − | #Yu98a pmid=9495771
| + | |
| − | #Yu98b pmid=9829960
| + | |
| − | #Steiner99 pmid=10027974
| + | |
| − | #Recchia99 pmid=10523315
| + | |
| − | #Barre00 pmid=11114887
| + | |
| − | #Aussel02 pmid=11832210
| + | |
| − | #Ip03 pmid=14633998
| + | |
| − | </biblio>
| + | |
| − | | + | |
| − | ==Other DNA recombination sites==
| + | |
| | | | |
| | <parttable>recombination_site_DNA</parttable> | | <parttable>recombination_site_DNA</parttable> |
| | | | |
| | <!-- To include a part in this table, include the categories "//DNA/recombinationsite" under the Hard Information tab of the part. --> | | <!-- To include a part in this table, include the categories "//DNA/recombinationsite" under the Hard Information tab of the part. --> |
| | + | |
| | + | __NOTOC__ |
Recombination sites are DNA sequences at which recombination events take place.
For details on the different recombination systems available via the Registry as well as how they work, see Recombination.
More...| Name | Description | Sequence | Length
|
|---|
| BBa_I11022 | Lambda attB, reverse complement | accactttgtacaagaaagctgggt | 25 |
| BBa_I11023 | Lambda attP | . . . tcactatcagtcaaaataaaatcattattt | 232 |
| BBa_I11032 | P22 ''attB'', reverse complement | acgaccttcgcattacgaatgcgctgc | 27 |
| BBa_I11033 | P22 ''attP'' | . . . gggacatatttgggacagaagtaccaaaaa | 260 |
| BBa_I718016 | lox66 | . . . cttggtatagcatacattatacgaacggta | 34 |
| BBa_I718017 | lox71 | . . . gttcgtatacgatacattatacgaagttat | 34 |
| BBa_I742101 | dif site with forward orientation | . . . tcggtgcgcataatgtatattatgttaaat | 31 |
| BBa_I742102 | dif site with reverse orientation | . . . tcatttaacataatatacattatgcgcacc | 31 |
| BBa_J3101 | Recombinational Enhancer (RE) for Hin/Hix inverting | . . . ctttctagtgcaaattgtgaccgcattttg | 77 |
| BBa_J44000 | hixC binding site for Salmonella typhimurium Hin recombinase | ttatcaaaaaccatggtttttgataa | 26 |
| BBa_J61020 | [FRT] | . . . ttcctatactttttagagaataggaacttc | 34 |
| BBa_J61046 | [Lox] site for recombination | . . . cttcgtataatgtatgctatacgaagttat | 34 |
| BBa_J72001 | {FRT} recombination site for flp recombinase in BBb | . . . ttcctatactttctagagaataggaacttc | 36 |
| BBa_K112141 | attR2 recombination site | . . . gttcagctttcttgtacaaagtggttgatc | 136 |
| BBa_K112142 | attR2 recombination site-reverse orientation | . . . aacacaacatatccagtcactatggtcgac | 136 |
| BBa_K137008 | fimE IRR | . . . gaaacatttggggccaaactgtccatatta | 35 |
| BBa_K137010 | fimE IRL | . . . gagtcaaaatggccccaattgtcttgtatt | 35 |
| BBa_K1680005 | loxP Site | . . . cttcgtatagcatacattatacgaagttat | 34 |
| BBa_K315011 | Variant reverse lox N | . . . cttcgtatagtataccttatacgaagttat | 34 |
| BBa_K3697003 | Homology Arms for KanR integration in B. Subtilis | . . . gcttgcaaacaaaaaaaccaccgctaccag | 1103 |
| BBa_K416002 | 36 Base Pair LoxP | . . . tcgtataatgtatgctatacgaagttatcg | 36 |
| BBa_K5276011 | TP901B-TC | . . . atcaaggtaaatgctttttgctttttttgc | 53 |
| BBa_K5276012 | TP901P-TC | . . . ttaattgaaataaacgaaataaaaactcgc | 50 |
| BBa_K863201 | 3' UTR site of alcohol oxidase 1 gene (aox1) | . . . tcatcaacttgaggggcactatcttgtttt | 676 |
| BBa_K886000 | Fixed lox71 | . . . gttcgtatagcatacattatacgaagttat | 34 |
