Difference between revisions of "Bacillus subtilis"
Line 11: | Line 11: | ||
</html> | </html> | ||
− | == | + | ==Constitutive promoters== |
{{:Promoters/Catalog/B._subtilis/Constitutive}} | {{:Promoters/Catalog/B._subtilis/Constitutive}} | ||
+ | |||
+ | ==Positively regulated promoters== | ||
{{:Promoters/Catalog/B._subtilis/Positive}} | {{:Promoters/Catalog/B._subtilis/Positive}} | ||
+ | |||
+ | ==Repressible promoters== | ||
{{:Promoters/Catalog/B._subtilis/Repressible}} | {{:Promoters/Catalog/B._subtilis/Repressible}} |
Revision as of 00:40, 13 December 2008
Bacillus subtilis is gram-positive model organism. Thus, much is known about this organism. The genome of Bacillus subtilis strain 168 has been sequenced.
Although the current part collection for B. subtilis is small, many are now using B. subtilis as a candidate host for synthetic devices and systems. Please read more about the advantages and disadvantages of using B. subtilis as a chassis.
Constitutive promoters
The promoters here are B. subtilis promoters that are constitutive meaning that the activity of these promoters should only be regulated by the levels of RNA polymerase and the appropriate σ factor.
The sequence of these promoter are adapted to the σ factor of B. subtilis. However, some of these promoter also works in E. coli. Generally speaking, standard E. coli promoters don't work (or are very weak) in B. subtilis strains, whereas the contrary generally works. However, it doesn't mean that the efficiency will be the same in both strains. The pVeg promoter, for instance, works fine at a high level of expression in both E. coli and B. subtilis strains - Contribution from User: Cyrpaut (31 October 2011)
Constitutive B. subtilis σA promoters
This section lists promoters that are recognized by B. subtilis σA RNAP. σA is the major B. subtilis sigma factor so there should be RNAP present to transcribe these promoters under most growth conditions (although maximally during exponential growth).
Name | Description | Promoter Sequence | Positive Regulators | Negative Regulators | Length | Doc | Status |
---|---|---|---|---|---|---|---|
BBa_K143012 | Promoter veg a constitutive promoter for B. subtilis | . . . aaaaatgggctcgtgttgtacaataaatgt | 97 | 6561 | In stock | ||
BBa_K143013 | Promoter 43 a constitutive promoter for B. subtilis | . . . aaaaaaagcgcgcgattatgtaaaatataa | 56 | 11873 | Not in stock | ||
BBa_K780003 | Strong constitutive promoter for Bacillus subtilis | . . . aattgcagtaggcatgacaaaatggactca | 36 | 1559 | It's complicated | ||
BBa_K823000 | PliaG | . . . caagcttttcctttataatagaatgaatga | 121 | 7765 | In stock | ||
BBa_K823002 | PlepA | . . . tctaagctagtgtattttgcgtttaatagt | 157 | 7245 | In stock | ||
BBa_K823003 | Pveg | . . . aatgggctcgtgttgtacaataaatgtagt | 237 | 14126 | In stock |
Constitutive B. subtilis σB promoters
This section lists promoters that are recognized by B. subtilis σB RNAP. σB is the major stationary phase E. coli sigma factor. Use these promoters when you want high promoter activity during stationary phase or during starvation.
Name | Description | Promoter Sequence | Positive Regulators | Negative Regulators | Length | Doc | Status |
---|---|---|---|---|---|---|---|
BBa_K143010 | Promoter ctc for B. subtilis | . . . atccttatcgttatgggtattgtttgtaat | 56 | 4297 | Not in stock | ||
BBa_K143011 | Promoter gsiB for B. subtilis | . . . taaaagaattgtgagcgggaatacaacaac | 38 | 2765 | Not in stock | ||
BBa_K143013 | Promoter 43 a constitutive promoter for B. subtilis | . . . aaaaaaagcgcgcgattatgtaaaatataa | 56 | 11873 | Not in stock |
Positively regulated promoters
The B. subtilis promoters of this section is the ones that are said to be positively regulated. It means that meaning their expression level increase with the help of another third party protein called transcription activator (This category exclude the sigma factor protein itself). With the appropriate protein, you would be able to increase the activity of your promoter. Please read the description and characterization of each parts for more details.
Positively regulated B. subtilis σA promoters
This section lists the promoters recognized by B. subtilis σA RNA polymerase sub-unit. σA is the major B. subtilis sigma factor that is present under most growth conditions (but maximal during exponential growth phase).
Name | Description | Promoter Sequence | Positive Regulators | Negative Regulators | Length | Doc | Status |
---|---|---|---|---|---|---|---|
BBa_K090504 | Gram-Positive Strong Constitutive Promoter | . . . acatgggaaaactgtatgtatttgatcctc | 239 | 2275 | It's complicated |
Positively regulated B. subtilis σB promoters
This section lists promoters that are recognized by B. subtilis σB RNA polymerase. σB is the polymerase subunit that is the most present during the stationary growth phase. You can use these promoters if you want your construct to be mostly expressed during stationary growth phase or under starvation conditions.
There are no parts for this table
Repressible promoters
The B. subtilis promoters of this section are said negativly regulated promoters, because they can be repressed by the expression of a third party protein. The inhibition can be released by the addition of a molecule, like for the LacI E. coli promoter.
In the following biobricks, the proposed promoters are build with the fusion of one or several operons with a σA type contitutive promoter.
Name | Description | Promoter Sequence | Positive Regulators | Negative Regulators | Length | Doc | Status |
---|---|---|---|---|---|---|---|
BBa_K090501 | Gram-Positive IPTG-Inducible Promoter | . . . tggaattgtgagcggataacaattaagctt | 107 | 2054 | It's complicated | ||
BBa_K143014 | Promoter Xyl for B.subtilis | . . . agtttgtttaaacaacaaactaataggtga | 82 | 2112 | Not in stock | ||
BBa_K143015 | Promoter hyper-spank for B. subtilis | . . . aatgtgtgtaattgtgagcggataacaatt | 101 | 2527 | Not in stock |
In the future, we may also find promoters builded with the σB promoter.
There are no parts for this table
References
Given the number of available articles on B. subtilis, we only include some review articles here.
<biblio>
- Earl pmid=18467096
- Pavlendova pmid=18450217
- Sonenshein pmid=17982469
- Lopez pmid=17981078
- Aguilar pmid=17977783
- Irnov pmid=17381303
</biblio>