Difference between revisions of "Bacillus subtilis"

Revision as of 00:37, 13 December 2008

Bacillus subtilis is gram-positive model organism. Thus, much is known about this organism. The genome of Bacillus subtilis strain 168 has been sequenced.

Although the current part collection for B. subtilis is small, many are now using B. subtilis as a candidate host for synthetic devices and systems. Please read more about the advantages and disadvantages of using B. subtilis as a chassis.

Promoters

Constitutive

The promoters here are B. subtilis promoters that are constitutive meaning that the activity of these promoters should only be regulated by the levels of RNA polymerase and the appropriate σ factor.

The sequence of these promoter are adapted to the σ factor of B. subtilis. However, some of these promoter also works in E. coli. Generally speaking, standard E. coli promoters don't work (or are very weak) in B. subtilis strains, whereas the contrary generally works. However, it doesn't mean that the efficiency will be the same in both strains. The pVeg promoter, for instance, works fine at a high level of expression in both E. coli and B. subtilis strains - Contribution from User: Cyrpaut (31 October 2011)

Constitutive B. subtilis σ^A promoters

This section lists promoters that are recognized by B. subtilis σ^A RNAP. σ^A is the major B. subtilis sigma factor so there should be RNAP present to transcribe these promoters under most growth conditions (although maximally during exponential growth).

*More...*
Name	Description	Promoter Sequence	Length	Doc	Status
BBa_K143012	Promoter veg a constitutive promoter for B. subtilis	. . . aaaaatgggctcgtgttgtacaataaatgt	97	6561	In stock
BBa_K143013	Promoter 43 a constitutive promoter for B. subtilis	. . . aaaaaaagcgcgcgattatgtaaaatataa	56	11873	Not in stock
BBa_K780003	Strong constitutive promoter for Bacillus subtilis	. . . aattgcagtaggcatgacaaaatggactca	36	1559	It's complicated
BBa_K823000	P_liaG	. . . caagcttttcctttataatagaatgaatga	121	7765	In stock
BBa_K823002	P_lepA	. . . tctaagctagtgtattttgcgtttaatagt	157	7245	In stock
BBa_K823003	P_veg	. . . aatgggctcgtgttgtacaataaatgtagt	237	14126	In stock

Constitutive B. subtilis σ^B promoters

This section lists promoters that are recognized by B. subtilis σ^B RNAP. σ^B is the major stationary phase E. coli sigma factor. Use these promoters when you want high promoter activity during stationary phase or during starvation.

*More...*
Name	Description	Promoter Sequence	Length	Doc	Status
BBa_K143010	Promoter ctc for B. subtilis	. . . atccttatcgttatgggtattgtttgtaat	56	4297	Not in stock
BBa_K143011	Promoter gsiB for B. subtilis	. . . taaaagaattgtgagcgggaatacaacaac	38	2765	Not in stock
BBa_K143013	Promoter 43 a constitutive promoter for B. subtilis	. . . aaaaaaagcgcgcgattatgtaaaatataa	56	11873	Not in stock

Positively regulated

The B. subtilis promoters of this section is the ones that are said to be positively regulated. It means that meaning their expression level increase with the help of another third party protein called transcription activator (This category exclude the sigma factor protein itself). With the appropriate protein, you would be able to increase the activity of your promoter. Please read the description and characterization of each parts for more details.

Positively regulated B. subtilis σ^A promoters

This section lists the promoters recognized by B. subtilis σ^A RNA polymerase sub-unit. σ^A is the major B. subtilis sigma factor that is present under most growth conditions (but maximal during exponential growth phase).

*More...*
Name	Description	Promoter Sequence	Positive Regulators	Negative Regulators	Length	Doc	Status
BBa_K090504	Gram-Positive Strong Constitutive Promoter	. . . acatgggaaaactgtatgtatttgatcctc			239	2275	It's complicated

Positively regulated B. subtilis σ^B promoters

This section lists promoters that are recognized by B. subtilis σ^B RNA polymerase. σ^B is the polymerase subunit that is the most present during the stationary growth phase. You can use these promoters if you want your construct to be mostly expressed during stationary growth phase or under starvation conditions.

There are no parts for this table

Repressible

The B. subtilis promoters of this section are said negativly regulated promoters, because they can be repressed by the expression of a third party protein. The inhibition can be released by the addition of a molecule, like for the LacI E. coli promoter.

In the following biobricks, the proposed promoters are build with the fusion of one or several operons with a σ_A type contitutive promoter.

*More...*
Name	Description	Promoter Sequence	Length	Doc	Status
BBa_K090501	Gram-Positive IPTG-Inducible Promoter	. . . tggaattgtgagcggataacaattaagctt	107	2054	It's complicated
BBa_K143014	Promoter Xyl for B.subtilis	. . . agtttgtttaaacaacaaactaataggtga	82	2112	Not in stock
BBa_K143015	Promoter hyper-spank for B. subtilis	. . . aatgtgtgtaattgtgagcggataacaatt	101	2527	Not in stock

In the future, we may also find promoters builded with the σ_B promoter.

There are no parts for this table

References

Given the number of available articles on B. subtilis, we only include some review articles here.

Earl pmid=18467096
Pavlendova pmid=18450217
Sonenshein pmid=17982469
Lopez pmid=17981078
Aguilar pmid=17977783
Irnov pmid=17381303

</biblio>

Revision as of 00:36, 13 December 2008 (view source) Rshetty (Talk \| contribs) (New page: < Back to Registry {{:Bacillus subtilis/Overview}} <html> <style> #assembly_plasmid_table {margin-left:auto;margin-right:auto; border: 3px solid #444444;} #assembly_plasmid...)		Revision as of 00:37, 13 December 2008 (view source) Rshetty (Talk \| contribs) Newer edit →
Line 29:		Line 29:

	{{:Bacillus subtilis/References}}		{{:Bacillus subtilis/References}}
		+
		+	__NOTOC__ __NOEDITSECTION__