Difference between revisions of "DNA/Recombination"

Line 2: Line 2:
  
 
<center>
 
<center>
[[DNA/Recombination#''Salmonella typhimurium''-derived Hin/''hix'' DNA recombination system|'''Hin/''hix''''']] &bull; [[DNA/Recombination#Bacteriophage P1 Cre/''lox'' DNA recombination system|'''Cre/'lox''''']] &bull;
+
[[DNA/Recombination#Salmonella typhimurium-derived Hin/hix DNA recombination system|'''Hin/''hix''''']] &bull; [[DNA/Recombination#Bacteriophage P1 Cre/lox DNA recombination system|'''Cre/'lox''''']] &bull; [[DNA/Recombination#Bacteriophage &lambda; att DNA recombination system|'''''att''''']]
 
</center>
 
</center>
  

Revision as of 13:17, 30 October 2008

< Back to DNA parts

Hin/hixCre/'loxatt

Salmonella typhimurium-derived Hin/hix DNA recombination system

KarmellaHaynesPhoto.jpg
Karmella Haynes and the [http://parts.mit.edu/wiki/index.php/Davidson_2006 2006 Davidson College/Missouri Western iGEM team], designed and constructed a set of parts from the Salmonella typhimurium-derived DNA recombination system. You can read more about the 2006 Davidson/Missouri Western project in their open-access paper [http://www.jbioleng.org/content/2/1/8 Engineering bacteria to solve the Burnt Pancake Problem] published in the Journal of Biological Engineering Haynes. The following is excerpted from their paper.

In Salmonella, Hin DNA recombinase (BBa_J31000, BBa_J31001) catalyzes an inversion reaction that regulates the expression of alternative flagellin genes by switching the orientation of a promoter located on a 1 kb invertible DNA segment Zieg,Zieg80. Two palindromic 26 bp hix sequences flank the invertible DNA segment and serve as the recognition sites for cleavage and strand exchange. A ~70 bp cis-acting recombinational enhancer (RE) increases efficiency of protein-DNA complex formation (BBa_J3101) Johnson. We have reconstituted the genetic elements required for DNA inversion as a collection of modular genetic elements for use in E. coli. Our system is a proof-of-concept genetic computing device that manipulates plasmid DNA processors within living cells.

In Salmonella, the asymmetrical palindromic sequences hixL and hixR flank the invertible DNA segment and serve as the recognition sites for cleavage and strand exchange. Our system uses hixC (BBa_J44000), a composite symmetrical hix site that shows higher binding affinity for Hin and a 16-fold slower inversion rate than wild type sites hixL and hixR Lim,Moskowitz.

We have demonstrated that a modified Hin/hix DNA recombination system can be used in vivo to manipulate at least two adjacent hixC-flanked DNA segments; HinLVA and hixC are sufficient for DNA inversion activity. The Hin/hix DNA recombination system could be used for other biological engineering applications. We have developed a set of modular genetic elements, hixC (BBa_J44000), RE (BBa_J3101), and HinLVA (BBa_J31001), that expands the repertoire of molecular tools for enzyme-mediated DNA manipulation in vivo.


More...
NameDescriptionSequenceRecombinaseLength
BBa_J3101Recombinational Enhancer (RE) for Hin/Hix inverting . . . ctttctagtgcaaattgtgaccgcattttg 77
BBa_J44000hixC binding site for Salmonella typhimurium Hin recombinasettatcaaaaaccatggtttttgataa 26


References

<biblio>

  1. Zieg pmid=322276
  2. Zieg80 pmid=6933466
  3. Johnson pmid=2548848
  4. Haykinson pmid=8508775
  5. PerkinsBalding pmid=9244261
  6. Haynes pmid=18492232
  7. Ham pmid=18665232
  8. Nanassy pmid=9691026
  9. Moswitz pmid=1885005
  10. Lim pmid=1597453

</biblio>


Bacteriophage P1 Cre/lox DNA recombination system

JCA Photo.png
Chris Anderson, a professor of bioengineering at UC Berkeley, constructed the lox recombination site BBa_J61046.
NoPhotoAvailable.jpg
Eimad Shotar, a member of the [http://parts.mit.edu/igem07/index.php/Paris 2007 Paris iGEM team], constructed the lox recombination sites BBa_I718016 and BBa_I718017.


The following text is excerpted from Siegel et al. Siegel04.

Bacteriophage P1 uses a site-specific recombination system that is responsible for partitioning newly synthesized genomic copies during replication Abremski, Hoess. This system is composed of a 38-kD phage-encoded Cre recombinase that mediates symmetrical recombination between two 34-bp loxP sites Abremski, which are recreated after recombination. Recombination between two compatible loxP sites will excise or invert the intervening DNA in the case of an intramolecular reaction or transfer suitably flanked loxP DNA in an intermolecular double cross-over recombination event. The Cre/loxP system does not require accessory factors to carry out recombination in vivo or in vitro, and studies have identified several hetero-specific loxP sequences that exclusively recombine with themselves, but not with wild-type lox Hoess86, Sauer92, Lee98, Siegel01. Importantly, the Cre/lox system has also been shown to be functional in site-specific recombination in mammalian cell lines Sauer88.


More...
NameDescriptionSequenceRecombinaseLength
BBa_I718016lox66 . . . cttggtatagcatacattatacgaacggta 34
BBa_I718017lox71 . . . gttcgtatacgatacattatacgaagttat 34
BBa_J61046[Lox] site for recombination . . . cttcgtataatgtatgctatacgaagttat 34
BBa_K1680005loxP Site . . . cttcgtatagcatacattatacgaagttat 34
BBa_K315011Variant reverse lox N . . . cttcgtatagtataccttatacgaagttat 34
BBa_K41600236 Base Pair LoxP . . . tcgtataatgtatgctatacgaagttatcg 36
BBa_K886000Fixed lox71 . . . gttcgtatagcatacattatacgaagttat 34


References

<biblio>

  1. Abremski pmid=6319400
  2. Hoess pmid=6230671
  3. Hamilton pmid=6333513
  4. Hoess86 pmid=3457367
  5. Sauer88 pmid=2839833
  6. Sauer92 pmid=1554399
  7. Lee98 pmid=9714735
  8. Sauer98 pmid=9608509
  9. Siegel01 pmid=11576551
  10. Sauer02 pmid=12624421
  11. Siegel04 pmid=15173117

</biblio>


Bacteriophage λ att DNA recombination system

The following is excerpted from Radman-Livaja et al. RadmanLivaja and Landy et al. Landy. It has been edited for clarity.

Bacteriophage λ has long served as a model system for studies of regulated site-specific recombination. In conditions favorable for bacterial growth, the phage genome is inserted into the Escherichia coli genome by an ‘integrative’ recombination reaction, which takes place between DNA attachment sites called attP and attB in the phage and bacterial genomes, respectively. As a result, the integrated λ DNA is bounded by hybrid attachment sites, termed attL and attR. In response to the physiological state of the bacterial host or to DNA damage, λ phage DNA excises itself from the host chromosome. This excision reaction recombines attL with attR to precisely restore the attP and attB sites on the circular λ and E. coli DNAs Campbell. The product of the phage gene int is required for both integration and excision of the λ prophage Zissler67.

The phage-encoded λ integrase protein (Int) splices together bacterial and phage attachment sites by a mechanism that is common to a large family of tyrosine recombinases with diverse biological functions (for reviews, see Hallett97, Azaro02). Recombination initiates with the pairing of two specific DNA segments by a tetramer of recombinase molecules. A four-way DNA junction (Holliday junction) is formed by the cleavage, exchange and ligation of one pair of strands, and is resolved to helical DNA products by the exchange of the second pair of strands Kitts88a, Kitts88b, NunesDuby87, Holliday64. The DNA cleavage activity is strictly regulated within the tetramer, with only one pair of molecules active at a time. This control ensures the ordered pairwise exchange of DNA strands and avoids potentially harmful double-strand breaks.

λ recombination has a strong directional bias in response to environmental conditions. Accessory factors, whose expression levels change in response to host physiology, control the action of Int and determine whether the phage genome will remain integrated or be excised. Int has two DNA-binding domains: a C-terminal domain, consisting of a catalytic domain and a core-binding (CB) domain, that interacts with the core recombining sites and an N-terminal domain (N-domain) that recognizes the regulatory arm DNA sites Wojciak02. The heterobivalent Int molecules bridge distant core and arm sites with the help of accessory proteins, such as integration host factor (IHF), which bend the DNA at intervening sites, and appose arm and core sequences for interaction with the Int recombinase. Five arm DNA sites in the regions flanking the core of attP are differentially occupied during integration and excision reactions. The integration products attL and attR cannot revert back to attP and attB without assistance from the phage-encoded factor Xis, which bends DNA on its own or in combination with the host-encoded factor Fis Abremski82,Abremski81,Hoess80,Thompson87a,Thompson87b,Ball91. Xis also inhibits integration, and prevents the attP and attB products of excision from reverting to attL and attR Abremski81,18]. Excision is inhibited by high concentrations of IHF <cite>Bushman85,Thompson86. Because the cellular levels of IHF and Fis proteins respond to growth conditions, these host-encoded factors have been proposed as the master signals for integration and excision Thompson87a,Bushman85,Thompson86, Nilsson92,Ball92, Ball91.

The following is excerpted from Landy et al. Landy. It has been edited for clarity.

The phage (attP) and bacterial (attB) att sites are designated POP’ and BOB’, respectively, and the prophage att sites are designated BOP’ (attL) and POB’ (attR). Transducing phage carrying attLgal) or attRbio) are generated from a prophage which has excised from the host chromosome by a rare int-independent recombination which deletes phage DNA from one end of the prophage and adds bacterial DNA to the other Campbell. A phage carrying the bacterial att site, BOB’, is obtained as a product of int-promoted recombination between a gal (BOP’) and a bio (POB’) transducing phage which is capable of transducing gal and bio together Echols70.

When Escherichia coli carries a deletion of the primary bacterial att site BOB’, int-dependent integration of λ can be detected at numerous loci (secondary bacterial att sites) on the E. coli chromosome Shimada72. This integration always involves the phage att site (POP’) Shimada75 and is thus very similar to the behavior of IS-elements Fiandt72, Hirsch72. The secondary prophage att sites are given the general designation ΔOP’ and POΔ’ and they differ from BOP’ and POB’ and from each other in their biological properties as determined by int- and xis -dependent recombination frequencies with various att sites.


More...
NameDescriptionSequenceRecombinaseLength
BBa_I11022Lambda attB, reverse complementaccactttgtacaagaaagctgggt 25
BBa_I11023Lambda attP . . . tcactatcagtcaaaataaaatcattattt 232
BBa_K112141attR2 recombination site . . . gttcagctttcttgtacaaagtggttgatc 136
BBa_K112142attR2 recombination site-reverse orientation . . . aacacaacatatccagtcactatggtcgac 136


References

<biblio>

  1. Campbell Campbell, AM. Episomes. In: Caspari EW, Thoday JM. , editors. Advances in Genetics. 1. New York: Academic Press; 1962. pp. 101–145.
  2. Zissler67 pmid=5637199
  3. Guameros70 pmid=4907272
  4. Kaiser70 pmid=4907271
  5. Echols70 pmid=4907273
  6. Shimada72 pmid=4552408
  7. Shimada75 pmid=1095763
  8. Fiandt72 pmid=4567155
  9. Hirsch72 pmid=4567154
  10. Hoess80 pmid=6446713
  11. Abremski81 pmid=6279866
  12. Abremski82 pmid=6213611
  13. Bushman85 pmid=2932798
  14. Thompson86 pmid=2946666
  15. Thompson87a pmid=2957063
  16. Thompson87b pmid=2958633
  17. Kitts88a pmid=2970060
  18. Kitts88b pmid=2975338
  19. NunesDuby87 pmid=3040260
  20. Holliday64 Holliday, R. A mechanism for gene conversion in fungi. Genet Res. 1964;5:282–304.
  21. Ball91 pmid=1829453
  22. Ball92 pmid=1459953
  23. Nilsson92 pmid=1732224
  24. Hallett97 pmid=9348666
  25. Azaro02 Azaro, MA; Landy, A. λ Int and the λ Int family. In: Craig NL, Craigie R, Gellert M, Lambowitz A. , editors. Mobile DNA II. Washington, DC: ASM Press; 2002. pp. 118–148.
  26. Wojciak02 pmid=11904406
  27. Landy pmid=331474
  28. Landy89 pmid=2528323
  29. RadmanLivaja pmid=16368232

</biblio>

E. coli XerCD/dif DNA recombination system

XiaonanWangPhoto.jpg Xiaonan Wang, a member of the [http://parts.mit.edu/igem07/index.php/Edinburgh 2007 University of Edinburgh iGEM team], designed the dif recombination sites BBa_I742101 and BBa_I742102.

The following text is excerpted from Ip et al. Ip03.

The separation and segregation of newly replicated [E. coli] circular chromosomes can also be prevented by the formation of circular chromosome dimers, which can arise during crossing over by homologous recombination Blakely91; Clerget91; Kuempel91. In E. coli, these dimers, which arise about once every six generations, are resolved to monomers by the action of the FtsK–XerCD–dif chromosome dimer resolution machinery Steiner98a, Steiner98b, Recchia99, Steiner99. Two site-specific recombinases of the tyrosine recombinase family, XerCD, act at a 28 bp recombination site, dif, located in the replication terminus region of the E. coli chromosome to remove the crossover introduced by dimer formation, thereby converting dimers to monomers. A complete dimer resolution reaction during recombination at dif requires the action of the C-terminal domain of FtsK (FtsKC) Steiner99; Barre00. FtsK is a multifunctional protein whose N-terminal domain acts in cell division, while the C-terminal domain functions in chromosome segregation Liu98; Wang98; Yu98a, Yu98b. Therefore, FtsK is well suited to coordinate chromosome segregation and cell division. A purified protein, FtsK50C, containing a functional C-terminal domain, can translocate DNA in an ATP-dependent manner and activate Xer recombination at the recombination site dif, thereby reconstituting in vitro the expected in vivo activities of the C-terminal domain of the complete FtsK protein Aussel02.


More...
NameDescriptionSequenceRecombinaseLength
BBa_I742101dif site with forward orientation . . . tcggtgcgcataatgtatattatgttaaat 31
BBa_I742102dif site with reverse orientation . . . tcatttaacataatatacattatgcgcacc 31


References

<biblio>

  1. Blakely91 pmid=1931824
  2. Clerget91 pmid=1931823
  3. Kuempel91 pmid=1657123
  4. Steiner98a pmid=9484882
  5. Steiner98b pmid=9829936
  6. Liu98 pmid=9723927
  7. Wang98 pmid=9723913
  8. Yu98a pmid=9495771
  9. Yu98b pmid=9829960
  10. Steiner99 pmid=10027974
  11. Recchia99 pmid=10523315
  12. Barre00 pmid=11114887
  13. Aussel02 pmid=11832210
  14. Ip03 pmid=14633998

</biblio>

Other DNA recombination sites


More...
NameDescriptionSequenceLength
BBa_I11022Lambda attB, reverse complementaccactttgtacaagaaagctgggt25
BBa_I11023Lambda attP . . . tcactatcagtcaaaataaaatcattattt232
BBa_I11032P22 ''attB'', reverse complementacgaccttcgcattacgaatgcgctgc27
BBa_I11033P22 ''attP'' . . . gggacatatttgggacagaagtaccaaaaa260
BBa_I718016lox66 . . . cttggtatagcatacattatacgaacggta34
BBa_I718017lox71 . . . gttcgtatacgatacattatacgaagttat34
BBa_I742101dif site with forward orientation . . . tcggtgcgcataatgtatattatgttaaat31
BBa_I742102dif site with reverse orientation . . . tcatttaacataatatacattatgcgcacc31
BBa_J3101Recombinational Enhancer (RE) for Hin/Hix inverting . . . ctttctagtgcaaattgtgaccgcattttg77
BBa_J44000hixC binding site for Salmonella typhimurium Hin recombinasettatcaaaaaccatggtttttgataa26
BBa_J61020[FRT] . . . ttcctatactttttagagaataggaacttc34
BBa_J61046[Lox] site for recombination . . . cttcgtataatgtatgctatacgaagttat34
BBa_J72001{FRT} recombination site for flp recombinase in BBb . . . ttcctatactttctagagaataggaacttc36
BBa_K112141attR2 recombination site . . . gttcagctttcttgtacaaagtggttgatc136
BBa_K112142attR2 recombination site-reverse orientation . . . aacacaacatatccagtcactatggtcgac136
BBa_K137008fimE IRR . . . gaaacatttggggccaaactgtccatatta35
BBa_K137010fimE IRL . . . gagtcaaaatggccccaattgtcttgtatt35
BBa_K1680005loxP Site . . . cttcgtatagcatacattatacgaagttat34
BBa_K315011Variant reverse lox N . . . cttcgtatagtataccttatacgaagttat34
BBa_K3697003Homology Arms for KanR integration in B. Subtilis . . . gcttgcaaacaaaaaaaccaccgctaccag1103
BBa_K41600236 Base Pair LoxP . . . tcgtataatgtatgctatacgaagttatcg36
BBa_K5276011TP901B-TC . . . atcaaggtaaatgctttttgctttttttgc53
BBa_K5276012TP901P-TC . . . ttaattgaaataaacgaaataaaaactcgc50
BBa_K8632013' UTR site of alcohol oxidase 1 gene (aox1) . . . tcatcaacttgaggggcactatcttgtttt676
BBa_K886000Fixed lox71 . . . gttcgtatagcatacattatacgaagttat34