Difference between revisions of "Promoters/Catalog/B. subtilis/Constitutive"
m |
|||
(4 intermediate revisions by 2 users not shown) | |||
Line 2: | Line 2: | ||
The promoters here are ''B. subtilis'' promoters that are '''constitutive''' meaning that the activity of these promoters should only be regulated by the levels of RNA polymerase and the appropriate σ factor. | The promoters here are ''B. subtilis'' promoters that are '''constitutive''' meaning that the activity of these promoters should only be regulated by the levels of RNA polymerase and the appropriate σ factor. | ||
<br style="clear:both" /> | <br style="clear:both" /> | ||
+ | |||
+ | <small>The sequence of these promoter are adapted to the σ factor of ''B. subtilis''. However, some of these promoter also works in ''E. coli''. Generally speaking, standard ''E. coli'' promoters don't work (or are very weak) in ''B. subtilis'' strains, whereas the contrary generally works. However, it doesn't mean that the efficiency will be the same in both strains. The pVeg promoter, for instance, works fine at a high level of expression in both ''E. coli'' and ''B. subtilis'' strains'' - '''Contribution from User: Cyrpaut (31 October 2011)'''</small> | ||
===Constitutive ''B. subtilis'' σ<sup>A</sup> promoters=== | ===Constitutive ''B. subtilis'' σ<sup>A</sup> promoters=== |
Latest revision as of 19:11, 25 June 2014
The promoters here are B. subtilis promoters that are constitutive meaning that the activity of these promoters should only be regulated by the levels of RNA polymerase and the appropriate σ factor.
The sequence of these promoter are adapted to the σ factor of B. subtilis. However, some of these promoter also works in E. coli. Generally speaking, standard E. coli promoters don't work (or are very weak) in B. subtilis strains, whereas the contrary generally works. However, it doesn't mean that the efficiency will be the same in both strains. The pVeg promoter, for instance, works fine at a high level of expression in both E. coli and B. subtilis strains - Contribution from User: Cyrpaut (31 October 2011)
Constitutive B. subtilis σA promoters
This section lists promoters that are recognized by B. subtilis σA RNAP. σA is the major B. subtilis sigma factor so there should be RNAP present to transcribe these promoters under most growth conditions (although maximally during exponential growth).
Name | Description | Promoter Sequence | Positive Regulators | Negative Regulators | Length | Doc | Status |
---|---|---|---|---|---|---|---|
BBa_K143012 | Promoter veg a constitutive promoter for B. subtilis | . . . aaaaatgggctcgtgttgtacaataaatgt | 97 | 6561 | In stock | ||
BBa_K143013 | Promoter 43 a constitutive promoter for B. subtilis | . . . aaaaaaagcgcgcgattatgtaaaatataa | 56 | 11873 | Not in stock | ||
BBa_K780003 | Strong constitutive promoter for Bacillus subtilis | . . . aattgcagtaggcatgacaaaatggactca | 36 | 1559 | It's complicated | ||
BBa_K823000 | PliaG | . . . caagcttttcctttataatagaatgaatga | 121 | 7765 | In stock | ||
BBa_K823002 | PlepA | . . . tctaagctagtgtattttgcgtttaatagt | 157 | 7245 | In stock | ||
BBa_K823003 | Pveg | . . . aatgggctcgtgttgtacaataaatgtagt | 237 | 14126 | In stock |
Constitutive B. subtilis σB promoters
This section lists promoters that are recognized by B. subtilis σB RNAP. σB is the major stationary phase E. coli sigma factor. Use these promoters when you want high promoter activity during stationary phase or during starvation.
Name | Description | Promoter Sequence | Positive Regulators | Negative Regulators | Length | Doc | Status |
---|---|---|---|---|---|---|---|
BBa_K143010 | Promoter ctc for B. subtilis | . . . atccttatcgttatgggtattgtttgtaat | 56 | 4297 | Not in stock | ||
BBa_K143011 | Promoter gsiB for B. subtilis | . . . taaaagaattgtgagcgggaatacaacaac | 38 | 2765 | Not in stock | ||
BBa_K143013 | Promoter 43 a constitutive promoter for B. subtilis | . . . aaaaaaagcgcgcgattatgtaaaatataa | 56 | 11873 | Not in stock |