Part:BBa_K5087024

SynCrRNA

Introduction

This part is the DNA template sequence of SynCrRNA—a crRNA molecule designed as a positive control for SHERLOCK assays. It includes both the direct repeat (DR) loop template and the spacer template.

Biology

Positive control in SHERLOCK assay

Controls are essential for conducting robust scientific research. In SHERLOCK tests, the synthetic DNA template acts as a positive control, ensuring that the materials used are of the appropriate quality and that the entire process is functioning as expected. Additionally, using synthetic DNA allows researchers to practice and refine the SHERLOCK detection method without wasting valuable nucleic acid samples [1].

For the DNA template to be detected a specifically designed crRNA is needed - in our case named SynCrRNA.

The crRNA

CrRNA (CRISPR-RNA) is the molecule that guides Cas13 proteins of the SHERLOCK [1] (Specific High Sensitivity Enzymatic Reporter Unlocking) platform to their specific targets, making it essential for accurate identification of the targeted sequence.

The crRNA consists of two key components: the DR (direct repeat) loop and the spacer sequence. The DR loop is crucial for attaching the Cas13 protein to the crRNA molecule, while the spacer is a 28-nucleotide programmable sequence complementary to the detection target. It enables the Cas13 protein to be accurately guided to the target for precise identification of the target sequence.

The SHERLOCK method

The SHERLOCK [1] platform is a modern synthetic biology tool that utilizes the properties of the Cas13a protein, an enzyme from the Nobel Prize-winning CRISPR-Cas system. The Cas13a protein is guided with high specificity to the target sequence using crRNA. The crRNA molecule is crucial for the assay's specificity and can detect even a two-nucleotide mismatch.

First, the target sequence is amplified using RPA [3] (Recombinase Polymerase Amplification). RPA is an isothermal nucleic acid amplification technique that operates at a temperature range of 37–42°C, distinguishing it from traditional PCR methods that require thermal cycling for denaturation and annealing of DNA.

Then the amplified target is transcribed in vitro into RNA. Now, the Cas13a protein binds to the transcribed RNA via its crRNA. Once activated, the Cas13a protein exhibits a "collateral" RNase activity, meaning it non-specifically cleaves nearby single-stranded RNA molecules [1].

This activity can be used in assays by including synthetic RNA probes tagged with a fluorescent reporter and a quencher in the reaction mixture. A fluorescent signal indicates that the reporters have been cleaved by Cas13, confirming the presence of the DNA target in the sample. The SHERLOCK method can also be used with Lateral Flow Assays (LFA).

Figure 2. The SHERLOCK (Specific High-sensitivity Enzymatic Reporter unLOCKing) Method Mechanism.

Design

This part was designed with a DR loop specific for LwaCas13a (BBa_K5087018) positioned at the 3’ end of the 28-bp spacer (the loop in the transcribed RNA will therefore be correctly positioned at the 5’ end [1]). The spacer of this crRNA was designed by Kellner et al. as a positive control for SHERLOCK assays. We recommend reading the spacer’s part page (BBa_K5087021) to learn more about the entire design process.

Note: This sequence includes only the components that directly form the crRNA molecule. We present it this way because there are several methods to produce the crRNA. You can either add a T7 promoter template (BBa_K5087028) to this sequence for traditional in vitro transcription or use our SynLOCK system (BBa_K5087017). Regardless of the method used to obtain the crRNA, it will contain the elements shown here and will be transcribed into the SynCrRNA molecule, whose sequence is provided in Table 1.

Figure 3. crRNA IVT template.

Table 1. The crRNA sequence obtained on the basis of the template

GAUUUAGACUACCCCAAAAACGAAGGGGACUAAAACCGCCAAGCUUGCAUGCCUGCAGGUCGAG

Build

We obtained SynCrRNA molecules by both methods: using the traditional in vitro transcription by appending the T7 promoter to the crRNA template sequence, as well as by incorporating the spacer of the SynCrRNA (BBa_K5087021) into the SynLOCK Cassette (BBa_K5087017)

Traditional In Vitro Transcription (IVT)

For this reaction, a T7 promoter template (BBa_K5087028) was appended to this part's sequence at the 3’ end.

1. The annealing reaction of the template with the T7-3G oligonucleotide (BBa_K5087016) was performed.

Table 2. Annealing Reaction Mix components (for a single reaction)

Component	Volume [µl]
crRNA template, 100 µM	1
T7-3G oligonucleotide, 100 µM	2
Standard Taq buffer, 10x	1
H₂O	7
Total	11

2. A 5-minute denaturation was conducted, after which the reaction was slowly cooled in a thermocycler to 4°C, at a rate of 0.1°C/s.

3. IVT (in vitro transcription) reaction was performed. The reaction mix content was as follows

Table 3. IVT Reaction Mix components (for a single reaction)

Component	Volume [µl]
H₂O	15
Annealing reaction mix	10
5x Buffer (from TranscriptAid T7 High Yield Transcription Kit, Thermo Scientific)	4
rNTP mix	8
Enzyme mix	2
Total	39

4. The reaction was incubated for 4 hours at 37°C. The sample was kept at -21°C until the next day. Then, the product was purified according to our protocol that can be found here.

Results — RNA electrophoresis

Sample preparation and electrophoresis

1. A dilution of the original syncrRNA solution was performed:

• 1 μl – RNA (c = 4530.9 ng/μl)

• 9 μl – DEPC H2O

2. The sample and marker mixes were prepared:

SynCrRNA

• 1.1 μl – syncrRNA diluted solution (c = 453.09 ng/μl)

• 4.9 μl – DEPC H2O

• 6 μl – RNA LB Buffer

Ladder

• 3 μl – RiboRuler High Range RNA Ladder (from TranscriptAid T7 High Yield Transcription Kit, Thermo Scientific, lot. 00150262)

• 3 μl – DEPC H2O

• 6 μl – RNA LB Buffer

3. RNA samples were heated at 70°C for 10 minutes, then immediately chilled on ice.

4. 12 μl of each of the samples were loaded onto the gel, alongside wells filled with LB Buffer, to maintain a straight line of sample migration.

5. Electrophoresis was conducted for 45 minutes under 100 V.

Staining the gel

1. After the electrophoresis was completed, the gel was soaked for 15 minutes in 1x TBE buffer solution to remove the remaining urea.

2. The gel was stained in ethidium bromide solution (c = 0.5 μg/ml) for 15 minutes. The staining solution was prepared, by adding 3.5 μl of ethidium bromide (c = 10 mg/ml) to 70 ml of 1x TBE buffer.

Figure 4. Gel electrophoresis of the obtained IVT reaction product.

Conclusions: A clear and distinct RNA band was observed, confirming that the IVT reaction was successful. Although the RNA ladder did not develop correctly, this does not impact the interpretation of the results.

SynLOCK system IVT

As part of our contribution to the synthetic biology community, we developed a crRNA synthesis system that allows scientists to easily obtain crRNAs with custom spacers. The SynLOCK system enables the creation of crRNAs with a 28-nucleotide spacer sequence tailored to the user's needs.

• For the generation of SynCrRNA, we used the SynCrRNA spacer (BBa_K5087021) sequence and directly cloned it into the SynLOCK Cassette (BBa_K5087017). You can read more on how to use the system and how to design the spacers on the Cassette’s part page.

• We then linearized the isolated plasmids carrying the SynLOCK system with BbsI-HF enzyme (New England Biolabs) according to the provided manual.

The digestion reaction was then visualised by gel electrophoresis.

Figure 5. Gel Electrophoresis Results of the digestion of SynLOCK system plasmids carrying respective crRNA templates with BbsI.

Conclusions: All plasmids were correctly linearized with BbsI, as indicated by a single band on the gel.

We then proceeded with in vitro transcription (IVT) and post-IVT cleanup, according to our optimized protocol which can be accessed here.

The obtained concentrations of crRNAs were as described in Table 4. For more information on the SVR and USV plasmids used to carry our system, visit the SynLOCK Cassette part page BBa_K5087017.

Table 4. Concentrations of obtained crRNAs using SynLOCK system

crRNA	Concentration [ng/μl]
SVR SyncrRNA	1637.9
SVR PrymcrRNA1	610.7
SVR PrymcrRNA2	1665
USV SyncrRNA	742
USV PrymcrRNA1	971.8
USV PrymcrRNA2	828.8
FLuc Control Template*	672.2

*The control was provided with the HiScribe® T7 High Yield RNA Synthesis Kit (New England Biolabs) we used for this IVT reaction.

Results — RNA electrophoresis

The samples were prepared by mixing:

• 1 μl – crRNA

• 9 μl – DEPC H2O

• 10 μl – RNA LB Buffer

A loading buffer without added EtBr was used to prepare the samples. Following separation at 90 V for approximately 40 minutes, the gel was first washed in the TBE buffer for 10 minutes. It was then washed in a TBE + EtBr solution for 10 minutes, and finally washed again in the TBE buffer for 10 minutes.

The Thermo Scientific RiboRuler High Range RNA Ladder (200 to 6000 bases) was used. All transcripts expected length was 64 bp, so bands below 200 bp would be assumed to be the correct transcripts.

Figure 6. RNA electrophoresis – SynLOCK system IVT results.

Conclusions:

In our results, we successfully obtained transcripts of the correct length (64 bp); however, some bands appeared faint, suggesting that the vectors may not have been fully digested with BbsI or that the DNase I treatment was only partially effective. Notably, visible contamination was observed in the SVR + PrymCrRNA2 sample, reinforcing the possibility of incomplete digestion or inadequate DNase I treatment. Despite these concerns, the samples were deemed sufficiently pure to proceed with further experiments, and no significant differences in gel results were noted compared to the traditional in vitro transcription (IVT) reaction, which also showed a faint band for PrymCrRNA2 and slight contamination across all crRNAs.

The correct single band at an expected transcript length confirms that the system is functioning as expected, establishing a proof of concept for SynLOCK. Overall, while further technical optimization is necessary to obtain purer molecules, our results support the system's functionality and potential for future development.

Test: Experimental Validation

This part works as a positive control when combined with SynF (BBa_K5087010) and SynR RPA primers (BBa_K5087011), as well as with the synthetic DNA target described by Kellner et al.[1]

The SHERLOCK reactions were carried out according to the protocol, which can be accessed here.

Figure 7. Fluorescence readout results demonstrate the performance of various part combinations from our toolkit. The bright green line (indicated as "synDNA1 syncrRNA") shows the SHERLOCK reaction where the synDNA1 template was first amplified via RPA using SynF and SynR primers and then detected using SynCrRNA.

Conclusions: Both PrymcrRNA designs were successful in detecting algal DNA. The synDNA + syncrRNA positive control functioned as expected, producing a strong fluorescence signal. When a mismatch between the DNA template and crRNA was introduced (PrymDNA + SynCrRNA), no signal was detected, confirming that the SynCrRNA is working properly.

PrymFlow

Introduction to the Lateral Flow Assay

The SHERLOCK method, like other CRISPR/Cas-based detection techniques, is compatible with a Lateral Flow readout format. The Lateral Flow Test is known for its speed, simplicity, and ease of interpretation. We aimed to adapt the previously optimized SHERLOCK components for use with Lateral Flow dipsticks, resulting in the development of the PrymFlow test for detecting the presence of Prymnesium parvum.

LFA Result Interpretation

If the target is present, the T-line becomes visible, indicating a positive result. Meanwhile, the C-line serves as a control that is less visible when greater amounts of the target sequence are present. Gold nanoparticles (GNPs) with anti-FAM antibodies provide the visual indication of the test result.

WHAT HAPPENS WHEN Prymnesium parvum IS NOT PRESENT IN THE WATER SAMPLE?

---

Streptavidin, immobilized on the C-line, captures the biotin-labeled ends of the intact reporters. The reporters are captured on the C-line, and the binding of gold nanoparticles (GNPs) conjugated with anti-FAM antibodies makes only the C (control) line visible.

AND WHEN IT IS PRESENT?

---

The reporters are cleaved by the activated Cas protein. Consequently, gold nanoparticles (GNPs) with anti-FAM antibodies capture the FAM-labeled fragments, which then bind to the anti-anti-FAM antibody immobilized on the test line (T-line), producing a strong signal. The presence of the T-line indicates the presence of Prymnesium parvum. Some intact reporters might remain in the mix (the amount depends on how many target DNA molecules were present in the sample, influencing the ratio of activated to non-activated Cas13 protein and the number of cleaved reporter molecules). As a result, a weak control line (C-line) is visible.

Figure 8. Explanation of the lines visible on the Lateral Flow test during a negative and positive result.

The LFA tests were conducted following the protocol, which can be accessed here.

Figure 9. SynF-SynR + SynCrRNA (Positive control).

Test sample 8, containing SynCrRNA, produced a 100% positive result, indicated by the presence of only the T-line (upper band) on the strip, confirming that this part can be used as a viable positive control for SHERLOCK assays.

Note: The remaining LFA strips pertain to other BioBrick parts or are not relevant to the conclusions presented here.

Sequence

Assembly Compatibility:

• 10
  INCOMPATIBLE WITH RFC[10]

  Illegal PstI site found at 7
  
• 12
  INCOMPATIBLE WITH RFC[12]

  Illegal PstI site found at 7
  
• 21
  COMPATIBLE WITH RFC[21]
• 23
  INCOMPATIBLE WITH RFC[23]

  Illegal PstI site found at 7
  
• 25
  INCOMPATIBLE WITH RFC[25]

  Illegal PstI site found at 7
  
• 1000
  COMPATIBLE WITH RFC[1000]

Biosafety

We used the Asimov's tool — Kernel — to check the sequence's safety with the Biosecurity Sequence Scanner. The results showed no flagged sequences, confirming that this part is safe to use.

Sequence source and Design

This sequence was introduced by Kellner et al. [1]. In the publication it is referred to as “Synthetic DNA 1 LwaCas13a crRNA IVT template”.

References

• [1] Kellner, Max J., Jeremy G. Koob, Jonathan S. Gootenberg, Omar O. Abudayyeh, and Feng Zhang. “SHERLOCK: Nucleic Acid Detection with CRISPR Nucleases.” Nature Protocols 14, no. 10 (October 2019): 2986–3012. https://doi.org/10.1038/s41596-019-0210-2.