Part:BBa_K5087017

SynLOCK Cassette

Introduction

This part is a key component of SynLOCK – the crRNA Synthesis System for SHERLOCK, designed, built and tested by iGEM JU-Krakow team to simplify and standardize the process of generating custom crRNA molecules. The SynLOCK Cassette enables the creation of crRNAs with a 28-nucleotide spacer sequence tailored to the user's needs. This makes SynLOCK a versatile and user-friendly platform for developing various detection tools that are compatible with simple Lateral Flow Assay (LFA) tests and can be used directly in the field.

The SynLOCK System

This Part is also a key member of the JU-Krakow Best Part Collection.

Our Best Part Collection is a carefully chosen set of parts that enable the creation of custom crRNA molecules for the SHERLOCK system. This collection was demonstrated to work in the detection of Prymnesium parvum. By introducing a streamlined process for generating new crRNA molecules, SynLOCK makes it easier and faster to create custom crRNA libraries tailored for different detection purposes. With our platform we wanted to ensure that the process of crRNA design and generation is straightforward and accessible to future iGEM teams.

Parts of our collection come with two badges to make it easier to distinguish which part is a customizable element of the system, allowing the user to create their own crRNAs for various detection applications, and which is specific to Prymnesium parvum, serving as a demonstrative target to showcase the collection’s efficiency and applicability.

	PrymDetect Toolkit — This badge marks parts specifically designed for the detection of Prymnesium parvum, demonstrating how the system can be applied to a real-world target.
	SynLOCK System — This badge indicates parts that enable users to design and create their own crRNAs.

What You Can Find in the Collection

From all the parts we assembled, we made an informed and careful decision about which parts to include in our collection. Finally, we opted for our:

• Optimized set of RPA primers for detecting Prymnesium parvum (BBa_K5087000 - BBa_K5087005) and primers for the control assay (BBa_K5087010 and BBa_K5087011).

• CrRNA spacers for the SynLOCK system, allowing for the creation of crRNAs for the detection of Prymnesium parvum (BBa_K50019 and BBa_K50020) and a spacer for the control crRNA (BBa_K5087021).

• The SynLOCK Cassette (BBa_K5087017).

• Full crRNA molecule templates for the above-mentioned spacers to demonstrate their performance (BBa_K5087022 - BBa_K5087024).

• Two reporter modules—one that we used within our Cassette (BBa_K5087025) and an alternative for further system customization (BBa_K5087026).

Biology

The crRNA molecule

CrRNA (CRISPR-RNA) is the molecule that guides Cas13a proteins of the SHERLOCK (Specific High Sensitivity Enzymatic Reporter Unlocking) platform to their specific targets, making it essential for accurate identification of the targeted sequence [1].

The crRNA consists of two key components: the DR loop and the spacer sequence. The DR loop is crucial for attaching the Cas13a protein to the crRNA molecule, while the spacer is a 28-nucleotide programmable sequence complementary to the detection target. It enables the Cas13a protein to be accurately guided to the target for precise identification.

CrRNA may be directly ordered as an RNA molecule, but it is more commonly obtained by ordering a DNA template, followed by in vitro transcription (IVT) to produce the crRNA. The ordered template is hybridized with a short primer containing the T7 promoter (BBa_K5087016), and then the IVT process is carried out to generate the final crRNA molecule [1]. By using the SynLOCK system, the use of this short primer can be omitted.

Figure 2. Depiction of a typical DNA template used for the generation of crRNA.

The SHERLOCK method

The SHERLOCK [1] (High Specificity Enzymatic Reporter Unlocking) platform is a modern synthetic biology tool that utilizes the properties of the Cas13a protein, an enzyme belonging to the Nobel Prize-winning CRISPR-Cas system. The Cas13a protein is guided with high specificity to the target sequence using crRNA. The crRNA molecule is crucial for the assay's specificity and can detect even a two-nucleotide mismatch.

First, the target sequence is amplified using RPA [2] (Recombinase Polymerase Amplification). RPA is an isothermal nucleic acid amplification technique that operates at a temperature range of 37–42°C, distinguishing it from traditional PCR methods that require thermal cycling for denaturation and annealing of DNA.

Then the amplified target is transcribed in vitro into RNA. Now, the Cas13a protein binds to the organism's genetic material via its crRNA. Once activated, Cas13a protein exhibits a collateral RNase activity, meaning it non-specifically cleaves nearby single-stranded RNA molecules [1].

This activity can be used in assays by including synthetic RNA probes tagged with a fluorescent reporter and a quencher in the reaction mixture. A fluorescent signal indicates that the reporters have been cleaved by Cas13, confirming the presence of the DNA target in the sample. The SHERLOCK method can also be used with Lateral Flow Assays (LFA) [1].

Figure 3. The SHERLOCK (Specific High-sensitivity Enzymatic Reporter unLOCKing) Method Mechanism.

Customization

Our system can be customized by the user on various levels and can accommodate:

• Different crRNA spacers, allowing to create a potentially infinite set of crRNA molecules for various detection purposes.

• Different proteins used with the SHERLOCK platform such as Cas13b by changing the DR sequence and/or its position within the Cassette.

• Various reporters of the user’s choice such as chromoproteins or fluorescent proteins.

User Guide & Experimental Validation

If you want to generate a crRNA molecule to detect any DNA or RNA sequence using the SHERLOCK system with the LwaCas13a protein, this user guide will help you through the process. This guide is supported by experimental data generated by our team to confirm the reliability of the system.

Design

Cassette Building Blocks

The SynLOCK Cassette is composed of several basic parts that together create a robust platform for crRNA synthesis:

• T7 promoter: Enables in vitro transcription using the plasmid carrying the SynLOCK Cassette as a template.

• LwaCas 13a DR (Direct Repeat): Allows the LwaCas13a protein to bind to the produced crRNA.

• SapI: Provides restriction sites for inserting a custom spacer sequence that is complementary to the detection target and excising the reporter for straightforward visual screening.

• Reporter unit: Positioned between the SapI cutting sites, it enables differentiation between bacteria that did not incorporate the spacer sequence (reporter remains present) and those that successfully incorporated it (reporter is absent).

• BbsI: Offers a restriction site to linearize the plasmid carrying the SynLOCK Cassette, ensuring in vitro transcription of crRNA of the correct length.

Figure 4. Incorporation of a custom crRNA spacer into the SynLOCK Cassette.

Design Context

Since the crRNA molecule acts as a precise guide for the Cas13a protein, it's essential to avoid introducing any scars or extra nucleotides into the Cassette throughout the entire design process. To achieve this, we designed our system to take advantage of the Type IIS assembly standard.

By integrating SapI restriction sites into the Cassette, users can insert custom spacer sequences that guide the resulting crRNA:Cas13a complex to their desired detection target. The orientation of these sites ensures that the SapI recognition sequence is removed during cloning, leaving no extra nucleotides behind.

Additionally, we included a BbsI restriction site to linearize the plasmid containing our system, ensuring efficient in vitro transcription of crRNA to the correct length. This site was strategically positioned to cleave precisely after the 28th nucleotide of the spacer, ensuring that the resulting crRNA molecule is exactly 64 nucleotides in length.

Genetic Context

Chassis

To achieve our goal of creating a system for easy cloning and multiplication of our construct, we used a bacterial system to multiply our plasmids, followed by a cell-free system for in vitro transcription to obtain pure crRNA molecules. Our system was tested in both TOP10 (Thermo Fisher) and NEB® 5-alpha (New England Biolabs) E. coli strains. We chose these specific strains because they are widely accessible to iGEM teams. The 5-alpha cells were provided to us by iGEM’s sponsor, New England Biolabs, and the TOP10 cells were commonly used in our lab. We optimized the protocols for transforming these cells with our constructs, which can be found here for the TOP10 cells and here for the NEB 5-alpha cells.

Plasmid Backbone Recommendations

Choosing the right plasmid backbone for the SynLOCK system is very important for its performance. It’s best to use a high copy number plasmid to maximize crRNA production. Additionally, the backbone should be as small as possible and free of extra, unnecessary parts. Since we’ll be adding a reporter to the Cassette for easier screening of correct colonies, the plasmid will become larger, so starting with a smaller backbone helps manage the overall size. We chose to use only the plasmid backbones available in the 2024 iGEM Distribution Kit to ensure that our platform is accessible to all participating teams.

Initially, our team assembled the system using the PSB1C5C plasmid due to its size and high copy number. However, after consulting with experts, we realized that a backbone compatible with more standards and capable of transferring the Cassette between different backbones would be preferable. We identified the pSB1C3 plasmid—a standard choice for storing BioBrick parts—as a better alternative. This plasmid not only met our desired criteria but also allowed for Cassette transfer after assembly by using BioBrick prefix and suffix cutting sites. In contrast, the PSB1C5C plasmid would permanently retain the Cassette due to the Type IIS assembly method used for insertion.

Note: The data showed that system performance was similar across the different plasmid backbones, as shown in Figure 16. You should choose the plasmid you’re most comfortable with based on your experimental needs. If transferring the Cassette (with or without the reporter or spacer) between different plasmids is important for your experiments, keep that in mind when making your choice.

It is crucial to double-check that the plasmid you are using does not contain SapI cutting sites in its sequence, as this enzyme will be used to incorporate the crRNA spacers into the Cassette!

Build

To clone the SynLOCK system into the PSB1C5C plasmid, we ordered the Cassette without the reporter, later referred to as the SynLOCK Cassette Spine, as two oligonucleotides that, after hybridization, formed 4-bp sticky ends. These ends are compatible with those created by digesting the PSB1C5C backbone with BsaI. You should include sticky ends that will be compatible with the backbone of your choice.

Note: After each enzymatic digestion performed in this user guide, we recommend cleaning up the reaction product according to our Post Enzymatic Reaction Clean-Up Protocol or a similar method.

Table 1. Sequences of the Two Oligonucleotides Used for Generating the Cassette
System_oligoF AATGGAAATTAATACGACTCACTATAGGGGATTTAGACTACCCCAAAAACGAAGGGGACTAAAACCGAAGAGCGAGCTCTTCCATGTCTTC
System_oligoR AAGCGAAGACATGGAAGAGCTCGCTCTTCGGTTTTAGTCCCCTTCGTTTTTGGGGTAGTCTAAATCCCCTATAGTGAGTCGTATTAATTTC

The oligonucleotide hybridization protocol used for this assembly can be found here, as well as the ligation protocol used to insert the Cassette Spine into the PSB1C5C backbone. After isolating the plasmid, we confirmed that the Cassette was correctly ligated through sequencing.

SynLOCK Cassette Spine Sequence Validation

Figure 5. The sequencing data shows that the SynLOCK Cassette Spine was ligated in its entirety with no undesired mutations.

Assembling the Reporter

The SynLOCK Cassette without a reporter can already accept custom crRNA spacers and generate crRNA molecules. However, after obtaining colonies from the spacer ligation reaction, you would need to conduct sequencing to verify whether the colony you picked contains the correct plasmid or if it is just an uncut or reclosed plasmid backbone with an empty Cassette. 

Our choice of reporter for the system was influenced by assembling seven different reporter units. We ultimately selected the BBa_K5087025 composite part, which we assembled from basic parts, because it produced a visible color faster than other assembled constructs, aligning with our goal for time efficiency. You can read more about the assembly of this part on its registry page. 

We also designed an alternative reporter, BBa_K5087026, which we are leaving for future iGEM teams to test within the system. Other alternatives can be used as well, allowing the reporter to be tailored to the user's specific needs. 

The reporter was PCR amplified with SapF (BBa_K5087012) and SapR (BBa_K5087013) primers. Our goal was to insert the reporter expression module into the Cassette spine to create the complete SynLOCK Cassette, while preserving the SapI recognition sites. These sites would later enable the reporter to be excised and replaced with the crRNA spacers. Additionally, the amplified product needed to have sticky ends after SapI digestion that would allow it to be ligated into the Cassette. All of this was achieved by carefully designing the SapF and SapR primers.

PCR Setup

A dilution of the matrix DNA (tsPurple Reporter Unit in the pJUMP29-1A backbone) for the PCR was prepared by mixing 2 µl of isolated plasmid (254 ng/µl) with 38 µl H₂O.

After pipetting the master mix into PCR tubes, 1 µl of the plasmid dilution was added to all samples except for the negative control (substituted with H₂O).

Table 2: PCR Reaction Master Mix Components (for a single reaction)

Component	Volume (µl)
Q5® High-Fidelity 2X Master Mix (New England Biolabs)	12.5
SapF (BBa_K5087012) primer (10 µM)	1.25
SapR primer (BBa_K5087013) (10 µM)	1.25
H₂O	9.0
Total	24

Thermocycler Program

• Initial denaturation: 98°C for 30s
• Denaturation: 98°C for 10s
• Annealing: 70°C (for negative control and one sample), 65°C (for another sample) for 15s
• Extension: 72°C for 25s
• Final extension: 72°C for 2min
• Hold: 4°C indefinitely

Steps 2, 3, and 4 were looped 30 times.

Note: The annealing temperature was calculated using the NEB Tm Calculator tool and was estimated at 72°C.

Figure 6. Electrophoresis of the BBa_K5087025 reporter module (indicated as TU5 for translational unit 5) amplified using SapF and SapR primers.

Conclusion: An anticipated 939 bp band was obtained. As expected, the 72°C annealing temperature yielded higher reaction efficiency, as indicated by the brighter band on the gel. However, the product was also successfully created at 65°C.

Inserting the Reporter into the Cassette

To make the process of screening easier, we decided to insert a reporter unit into the Cassette. The reaction was carried out following our DNA Ligation Protocol For Cohesive Ends.

Observations

Figure 7. Results of obtaining the SVR (System Vector Reporter) carrying colonies.

Conclusions: All colonies were visibly purple. The used plasmid backbone (PSB1C5C) is a high copy plasmid, therefore intense color was visible in the morning after just one night of incubation.

Figure 8. Overnight cultures of SVR colonies.

Conclusions: The chromoprotein production in SVR vectors is very high — the color is easily observed after an overnight incubation on a plate and in a liquid culture as well. This is the first time we observed color in a liquid culture without having to centrifuge it.

The plasmid preparation was carried out from both liquid cultures according to Plasmid Isolation Protocol I. For each sample, 4 ml of the liquid culture were used, and for each culture (SVR1 and SVR2) two plasmid preps were carried out, yielding four samples. 

Figure 9. SVR pellets formed after centrifugation during the plasmid isolation protocol.

Sapl digestion of the SVR plasmids

Purpose: To ensure that the SapI recognition sites were preserved within the Cassette sequence, a digestion reaction was prepared using this enzyme, following the manual provided by New England Biolabs.

Figure 10. Gel electrophoresis of the SVR plasmids digested by SapI.

Conclusion: Anticipated bands were obtained at 934 and 2115 bp for both SVR1 and SVR2 samples. A small fraction of the plasmid remained undigested, marked by the band on 3049 bp. Both SVR plasmids after isolation could be used for further experiments.

Changing the Plasmid Backbone

After consulting with Vinoo Selvarajah, the Vice President of Technology at iGEM, we decided to change the plasmid backbone for our system. This decision was made after thoroughly considering the points we had already discussed in the backbone considerations section of this page. We aimed to make the system compatible with the RCF10 standard and allow for Cassette transfer between different backbones using BioBrick assembly. To achieve this, we needed to introduce EcoRI and SpeI sites to flank our Cassette, which was the objective of this PCR reaction.

We chose EcoRI and SpeI due to their availability in our laboratory and the fact that they create different sticky ends within our construct, preventing issues with insert orientation during cloning.

PCR Setup:

1. For this PCR, the 340 ng/μl sample of SVR1 was chosen. It was diluted by taking 2 μl of the sample and adding 48 μl of water.

2. Two reactions were prepared in the final volume of 25 µl.

Table 3. PCR Reaction Master Mix components (for a single reaction):

Component	Volume (µl)
Q5® High-Fidelity 2X Master Mix (New England Biolabs)	12.5
EcoF (BBa_K5087014) primer (10 µM)	1.25
SpeR (BBa_K5087015) primer (10 µM)	1.25
H₂O	9.0
Total	24

After pipetting the master mix into PCR tubes, 1 µl of the SVR plasmid dilution was added to all samples except for the negative control (substituted with H₂O).

Thermocycler Program:

1. Initial denaturation: 98°C for 30s
2. Denaturation: 98°C for 10s
3. Annealing: 70°C (for negative control and one sample), 65°C (for another sample) for 15s
4. Extension: 72°C for 25s
5. Final extension: 72°C for 2min
6. Hold: 4°C indefinitely

Steps 2, 3, and 4 were looped 30 times.

Note: The annealing temperature was calculated using the NEB Tm Calculator tool and was estimated at 72°C. The negative control was performed at 70°C.

Figure 11. Gel electrophoresis results of the PCR adding EcoRI and SpeI restriction sites to the Cassette.

Conclusions: Expected bands of 1045 bp were obtained. 

The resulting PCR product was then digested with EcoRI and SpeI to obtain sticky ends. The same digestion was done to the PSB1C3 backbone taken from the 2024 iGEM Distribution Kit, and both elements were ligated according to the DNA Ligation Protocol For Cohesive Ends.

Figure 12. a) The transformation results of the ligation reaction creating the USV (Ultimate System Vector) plasmid visualized against white background and b) purple background. c) the negative control.

Conclusions: The ligation reaction was successful, as indicated by the purple color of the colonies, which confirms that the reporter was ligated correctly.

The isolated USV plasmid sample was then digested with EcoRI and SpeI to demonstrate that the Cassette unit can now be transferred between Biobrick-compatible plasmid backbones. Additionally, a SapI digestion was performed to confirm that the reporter protein transcription unit could be excised and substituted by a crRNA spacer. The reactions were incubated at 37°C for 30 minutes.

Figure 13. Electrophoresis results displaying the digestion of USV plasmid with the enzymes indicated in the image.

Table 4. Expected band size for each digestion of the USV plasmid.

Enzyme/s used	Expected Band Size (bp)
EcoRI & SpeI	2047 & 1031
SapI	2144 & 934

Conclusion: The correct bands were obtained, confirming that the Cassette can now be transferred between backbones and that the SapI sites were preserved, allowing for the insertion of crRNA spacers.

Cloning Experience tailored to your needs