Part:BBa_K5087023

PrymCrRNA2

Introduction

This part is the DNA template sequence of PrymCrRNA2—a crRNA molecule designed to target the ITS2 sequence of Prymnesium parvum, a harmful algal species. It includes both the direct repeat (DR) loop template and the spacer template.

Biology

The ITS sequences

The ITS2 (Internal Transcribed Spacer 2) region is a non-coding segment of DNA found within the ribosomal RNA (rRNA) gene cluster. In the genome of Prymnesium parvum, the ITS2 region lies between the 5.8S and nuclear large rRNA genes [1].

The ITS regions, including ITS2, are commonly used for species identification because they tend to vary between species. This variability makes the ITS2 region an effective target for designing species-specific primers and crRNA molecules.

The crRNA

CrRNA (CRISPR-RNA) is the molecule that guides Cas13 proteins of the SHERLOCK [2] (Specific High Sensitivity Enzymatic Reporter Unlocking) platform to their specific targets, making it essential for accurate identification of the targeted sequence.

The crRNA consists of two key components: the DR (direct repeat) loop and the spacer sequence. The DR loop is crucial for attaching the Cas13 protein to the crRNA molecule, while the spacer is a 28-nucleotide programmable sequence complementary to the detection target. It enables the Cas13 protein to be accurately guided to the target for precise identification of the target sequence.

The SHERLOCK method

The SHERLOCK [2] platform is a modern synthetic biology tool that utilizes the properties of the Cas13a protein, an enzyme from the Nobel Prize-winning CRISPR-Cas system. The Cas13a protein is guided with high specificity to the target sequence using crRNA. The crRNA molecule is crucial for the assay's specificity and can detect even a two-nucleotide mismatch.

First, the target sequence is amplified using RPA [3] (Recombinase Polymerase Amplification). RPA is an isothermal nucleic acid amplification technique that operates at a temperature range of 37–42°C, distinguishing it from traditional PCR methods that require thermal cycling for denaturation and annealing of DNA.

Then the amplified target is transcribed in vitro into RNA. Now, the Cas13a protein binds to the transcribed RNA via its crRNA. Once activated, the Cas13a protein exhibits a "collateral" RNase activity, meaning it non-specifically cleaves nearby single-stranded RNA molecules [2].

This activity can be used in assays by including synthetic RNA probes tagged with a fluorescent reporter and a quencher in the reaction mixture. A fluorescent signal indicates that the reporters have been cleaved by Cas13, confirming the presence of the DNA target in the sample. The SHERLOCK method can also be used with Lateral Flow Assays (LFA).

Figure 2. The SHERLOCK (Specific High-sensitivity Enzymatic Reporter unLOCKing) Method Mechanism.

Design

This part was designed with a DR loop specific for LwaCas13a (BBa_K5087018) positioned at the 3’ end of the 28-bp spacer (the loop in the transcribed RNA will therefore be correctly positioned at the 5’ end [2]). The spacer of this crRNA was designed using our own sequencing data from the Oder River strain of Prymnesium parvum, along with meticulous genomic analysis. We recommend reading the spacer’s part page (BBa_K5087020) to learn more about the entire design process.

Note: This sequence includes only the components that directly form the crRNA molecule. We present it this way because there are several methods to produce the crRNA. You can either add a T7 promoter template (BBa_K5087028) to this sequence for traditional in vitro transcription or use our SynLOCK system (BBa_K5087017). Regardless of the method used to obtain the crRNA, it will contain the elements shown here and will be transcribed into the PrymCrRNA molecule, whose sequence is provided in Table 1.

Figure 3. crRNA IVT template.

Table 1. The crRNA sequence obtained on the basis of the template

GAUUUAGACUACCCCAAAAACGAAGGGGACUAAAACGAGGAUCCUCCCGUGCAACGCUGCCCUC

Build

We obtained our PrymCrRNA2 molecules as well as the control construct, SynCrRNA (BBa_K5087024), by both methods: using the traditional in vitro transcription by appending a sequence complementary to the T7 promoter (BBa_K5087028) to the crRNA template sequence, as well as by incorporating the spacer (BBa_K5087020) of this crRNA into the SynLOCK Cassette (BBa_K5087017).

Traditional In Vitro Transcription (IVT)

• For this reaction, a T7 promoter template (BBa_K5087028) was appended to the 3’ end of this part's sequence, resulting in the following template sequence: GAGGGCAGCGTTGCACGGGAGGATCCTCGTTTTAGTCCCCTTCGTTTTTGGGGTAGTCTAAATCCCCTATAGTGAGTCGTATTAATTTC

• An annealing reaction of the template with the T7-3G oligonucleotide (BBa_K5087016) was performed [2].

Table 2. Annealing Reaction Mix components (for a single reaction)

Component	Volume [µl]
crRNA template, 100 µM	1
T7-3G oligonucleotide, 100 µM	2
Standard Taq buffer, 10x	1
H₂O	7
Total	11

• A 5-minute denaturation was conducted, after which the reaction was slowly cooled in a thermocycler to 4°C, at a rate of 0.1°C/s.

• IVT reaction was performed for both PrymCrRNA1 and PrymCrRNA2 samples. The reaction mix content was as follows:

Table 3. IVT Reaction Mix components (for a single reaction)

Component	Volume [µl]
H₂O	13
Annealing reaction mix	10
5x Buffer (from TranscriptAid T7 High Yield Transcription Kit, Thermo Scientific)	4
rNTP mix	10
Enzyme mix	2
Total	39

The reaction ran for 4 hours at 37°C. The samples were kept at -21°C until the next day. Then, the product was purified according to our protocol that can be found here.

Obtained concentrations of crRNAs were as follows:

• PrymcrRNA1.1: 431.3 ng/µl (A260/A280 = 2.18 ; A260/A230 = 2.52)
• PrymcrRNA1.2: 191.5 ng/µl (A260/A280 = 2.14 ; A260/A230 = 2.51)
• PrymcrRNA2: 7292.7 ng/µl (A260/A280 = 2.08 ; A260/A230 = 2.41)

Results — RNA electrophoresis

Samples were prepared accordingly:

PrymcrRNA1.1

• 1 μl – crRNA

• 9 μl – DEPC H2O

• 10 μl – RNA LB Buffer

PrymcrRNA1.2

• 3 μl – crRNA

• 7 μl – DEPC H2O

• 10 μl – RNA LB Buffer

PrymcrRNA2 – first, a dilution was prepared, by combining 1 μl of the original sample with 14 μl of H2O, resulting in a concentration = 431 ng/μl

• 1 μl – crRNA

• 9 μl – DEPC H2O

• 10 μl – RNA LB Buffer

1. RNA samples were heated at 70°C for 10 minutes, and then immediately chilled on ice.

2. 20 μl of each of the samples was loaded onto the gel preceded by 6 μl of RiboRuler High Range RNA Ladder (from TranscriptAid T7 High Yield Transcription Kit, Thermo Scientific).

3. The electrophoresis ran under 100 V for 45 minutes in 1x TBE buffer.

Staining the gel

After the electrophoresis was completed, the gel was soaked for 15 minutes in 1x TBE buffer solution to remove the remaining urea.

The gel was stained in ethidium bromide solution (c = 0.5 μg/ml) for 15 minutes. The staining solution was prepared, by adding 3.5 μl of ethidium bromide (c = 10 mg/ml) to 70 ml of 1x TBE buffer.

Figure 4. Gel electrophoresis of the obtained IVT reaction product; 1 – RNA ladder, 2,3 – PrymcrRNA1, 4 – PrymcrRNA2.

Conclusions

The product obtained appears to be the correct length. The additional bands observed may be due to contamination or product degradation. Despite this, the samples were considered pure enough to proceed with further experiments.

SynLOCK system IVT

As part of our contribution to the synthetic biology community, we developed a crRNA synthesis system that allows scientists to easily obtain crRNAs with custom spacers. The SynLOCK system enables the creation of crRNAs with a 28-nucleotide spacer sequence tailored to the user's needs.

• For the generation of PrymCrRNA2, we used the PrymCrRNA2 spacer (BBa_K5087020) sequence and directly cloned it into the SynLOCK Cassette (BBa_K5087017). You can read more on how to use the system and how to design the spacers on the Cassette’s part page.

• We then linearized the isolated plasmids carrying the SynLOCK system with BbsI-HF enzyme (New England Biolabs) according to the provided manual.

The digestion reaction was then visualised by gel electrophoresis.

Figure 5. Gel Electrophoresis Results of the digestion of SynLOCK system plasmids carrying respective crRNA templates with BbsI.

Conclusions: All plasmids were correctly linearized with BbsI, as indicated by a single band on the gel.

We then proceeded with in vitro transcription (IVT) and post-IVT cleanup, according to our optimized protocol which can be accessed here.

The obtained concentrations of crRNAs were as described in Table 4. For more information on the SVR and USV plasmids used to carry our system, visit the SynLOCK Cassette part page (BBa_K5087017).

Table 4. Concentrations of obtained crRNAs using SynLOCK system

crRNA	Concentration [ng/μl]
SVR SyncrRNA	1637.9
SVR PrymcrRNA1	610.7
SVR PrymcrRNA2	1665
USV SyncrRNA	742
USV PrymcrRNA1	971.8
USV PrymcrRNA2	828.8
FLuc Control Template*	672.2

*The control was provided with the HiScribe® T7 High Yield RNA Synthesis Kit (New England Biolabs) we used for this IVT reaction.

Results — RNA electrophoresis

The samples were prepared by mixing:

• 1 μl – crRNA

• 9 μl – DEPC H2O

• 10 μl – RNA LB Buffer

A loading buffer without added EtBr was used to prepare the samples. Following separation at 90 V for approximately 40 minutes, the gel was first washed in the TBE buffer for 10 minutes. It was then washed in a TBE + EtBr solution for 10 minutes, and finally washed again in the TBE buffer for 10 minutes.

The Thermo Scientific RiboRuler High Range RNA Ladder (200 to 6000 bases) was used. All transcripts expected length was 64 bp, so bands below 200 bp would be assumed to be the correct transcripts.

Figure 6. RNA electrophoresis – SynLOCK system IVT results.

Conclusions:

In our results, we successfully obtained transcripts of the correct length (64 bp); however, some bands appeared faint, suggesting that the vectors may not have been fully digested with BbsI or that the DNase I treatment was only partially effective. Notably, visible contamination was observed in the SVR + PrymCrRNA2 sample, reinforcing the possibility of incomplete digestion or inadequate DNase I treatment. Despite these concerns, the samples were deemed sufficiently pure to proceed with further experiments, and no significant differences in gel results were noted compared to the traditional in vitro transcription (IVT) reaction, which also showed a faint band for PrymCrRNA2 and slight contamination across all crRNAs.

The correct single band at an expected transcript length confirms that the system is functioning as expected, establishing a proof of concept for SynLOCK. Overall, while further technical optimization is necessary to obtain purer molecules, our results support the system's functionality and potential for future development.

Test: Part Performance

We tested this part in SHERLOCK assays aimed at detecting Prymnesium parvum DNA. We combined this part with each RPA primer pair we assembled to determine which primer pairs worked best with this crRNA. In our tests we used the LwaCas13a protein.

The SHERLOCK reactions were carried out according to the protocol, which can be accessed here.

Figure 7. Fluorescence readout results demonstrating the performance of various part combinations from our toolkit, with the PrymCrRNA2 molecule serving as the connecting component. The fluorescence intensity of the negative controls has been subtracted from the obtained fluorescence intensity results.

Fluorescent readouts suggest that PrymCrRNA2 operates best when used with ModF (BBa_K5087002) and GalR (BBa_K5087001) primers or GalF (BBa_K5087000) and GalR (BBa_K5087001).

PrymFlow

Introduction to the Lateral Flow Assay

The SHERLOCK method, like other CRISPR/Cas-based detection techniques, is compatible with a Lateral Flow readout format. The Lateral Flow Test is known for its speed, simplicity, and ease of interpretation. We aimed to adapt the previously optimized SHERLOCK components for use with Lateral Flow dipsticks, resulting in the development of the PrymFlow test for detecting the presence of Prymnesium parvum.

LFA Result Interpretation

If the target is present, the T-line becomes visible, indicating a positive result. Meanwhile, the C-line serves as a control that is less visible when greater amounts of the target sequence are present. Gold nanoparticles (GNPs) with anti-FAM antibodies provide the visual indication of the test result.

WHAT HAPPENS WHEN Prymnesium parvum IS NOT PRESENT IN THE WATER SAMPLE?

---

Streptavidin, immobilized on the C-line, captures the biotin-labeled ends of the intact reporters. The reporters are captured on the C-line, and the binding of gold nanoparticles (GNPs) conjugated with anti-FAM antibodies makes only the C (control) line visible.

AND WHEN IT IS PRESENT?

---

The reporters are cleaved by the activated Cas protein. Consequently, gold nanoparticles (GNPs) with anti-FAM antibodies capture the FAM-labeled fragments, which then bind to the anti-anti-FAM antibody immobilized on the test line (T-line), producing a strong signal. The presence of the T-line indicates the presence of Prymnesium parvum. Some intact reporters might remain in the mix (the amount depends on how many target DNA molecules were present in the sample, influencing the ratio of activated to non-activated Cas13 protein and the number of cleaved reporter molecules). As a result, a weak control line (C-line) is visible.

Figure 8. Explanation of the lines visible on the Lateral Flow test during a negative and positive result.

The LFA tests were conducted following the protocol, which can be accessed here.

Figure 9. 2. Negative control GalF-GalR-PrymCrRNA2; 6. Prymnesium parvum DNA (post PCR, 200 nM) GalF-GalR + PrymCrRNA2; 7. Prymnesium parvum DNA (post PCR, 200 pM) GalF-GalR + PrymCrRNA2; 8. Prymnesium parvum DNA (post PCR, 200 fM) GalF-GalR + PrymCrRNA2; 9. Positive control.

Positive test results were obtained for the samples containing Prymnesium parvum DNA isolated from algal cultures post PCR (Samples 6 and 7). The negative result was observed in Sample 8. The corresponding negative control (Sample 2) gave negative results.

Note: The remaining LFA strips pertain to other BioBrick parts or are not relevant to the conclusions presented here.

Figure 7 shows that PrymCrRNA2 performs best with the ModF (BBa_K5087002) and GalR (BBa_K5087001) primers. This combination was not tested in the LFA assays, as we prioritised other more promising RPA primer-PrymCrRNA pairs, such as ModF-GalR-PrymCrRNA1.

Learn

The design of crRNA molecules requires thorough optimization, as our data showed that the RPA primer pairs used with the crRNAs significantly impact part performance. Our experimental data allowed us to evaluate the PrymCrRNA2 part in combination with different primer pairs, leading to the following conclusions:

• The ModF (BBa_K5087002) and GalR (BBa_K5087001) primers produced the highest fluorescence intensity when measured on a plate reader.

• PrymCrRNA2 works effectively with the GalF (BBa_K5087000) and GalR (BBa_K5087001) primers, as demonstrated by the LFA test presented above. In our SHERLOCK tests we assessed that this combination can detect 200 fM of Prymnesium parvum DNA post PCR.

Detection of Prymnesium Types through Genomic Analysis

Our genomic analysis has identified which types of Prymnesium can be detected with our primer and crRNA combinations. This determination is based on the ITS sequence, which corresponds to the specific type of prymnesin produced by the algae[7].

Classification of Prymnesins

Prymnesins are classified into three distinct types based on the structure of their carbon backbone [8]:

• A-type Prymnesins: Have the largest carbon backbone with 91 carbon atoms. They are the most potent, exhibiting significant ichthyotoxic (fish-killing) properties.
• B-type Prymnesins: Feature a carbon backbone of 85 carbon atoms. They lack certain ring structures found in A-types and are generally less potent, though still toxic.
• C-type Prymnesins: Possess the shortest carbon backbone with 83 carbon atoms and show significant structural diversity. Their toxicity is variable and less well-characterized compared to A- and B-types.

Table 5: crRNA Combinations and Their Detection Capabilities

crRNA Combination	Target Region	Detected Types
PrymCrRNA1	ITS2	Type A and B
PrymCrRNA2	ITS2	Type A, B, and some C

Sequence

Assembly Compatibility:

• 10
  COMPATIBLE WITH RFC[10]
• 12
  COMPATIBLE WITH RFC[12]
• 21
  INCOMPATIBLE WITH RFC[21]

  Illegal BamHI site found at 21
  
• 23
  COMPATIBLE WITH RFC[23]
• 25
  COMPATIBLE WITH RFC[25]
• 1000
  COMPATIBLE WITH RFC[1000]

Primer and crRNA Collection Binding Sites

Here, we illustrate the positioning of all primers and crRNAs in our PrymDetect Toolkit on the ribosomal cistron of Prymnesium parvum genomic DNA.

Figure 10. Positioning of primers and crRNAs from the PrymDetect Toolkit on the ribosomal cistron of Prymnesium parvum genomic DNA.

Biosafety

We used the Asimov's tool — Kernel — to check the sequence's safety with the Biosecurity Sequence Scanner. The results showed no flagged sequences, confirming that this part is safe to use.

References

• [1] White, T.J., Bruns, T., Lee, S., & Taylor, J. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In PCR Protocols: A Guide to Methods and Applications. Academic Press. Published online 1990.
• [2] Kellner, Max J., Jeremy G. Koob, Jonathan S. Gootenberg, Omar O. Abudayyeh, and Feng Zhang. “SHERLOCK: Nucleic Acid Detection with CRISPR Nucleases.” Nature Protocols 14, no. 10 (October 2019): 2986–3012. https://doi.org/10.1038/s41596-019-0210-2.
• [3] Lobato IM, O’Sullivan CK. Recombinase polymerase amplification: Basics, applications and recent advances. Trends Analyt Chem. 2018;98:19-35. doi:10.1016/j.trac.2017.10.015.

</html>