Primers/Catalog

< Back to Primers

Sequencing parts • Amplifying parts • Amplifying plasmid backbones • GFP/YFP/CFP primers • Common primers

Sequencing of BioBrick parts

When working with BioBrick parts, a common operation is to verify the sequence of the cloned BioBrick part. To [http://openwetware.org/wiki/Sequencing_DNA sequence the part], most people send sequencing samples to either a core facility at their institution or to commercial DNA sequencing services. The sample should include not only DNA encoding the part, either in linear form from PCR or as circular plasmid DNA, but also a primer to direct where sequencing should begin. Thus, for convenience, most BioBrick plasmid backbones include standard primer annealing sites for the VF2 and VR primers. The VF2 and VR primers flank the BioBrick cloning site but are sufficiently distant from the cloning site to ensure high quality sequencing reads. (Generally, sequencing only starts to yield good quality sequence reads about 50-75 bases from the 3' end of the sequencing primer.)

More...

Name	Description	Sequence	Direction	Target	%GC	Tm	Length
BBa_G00100	Forward primer for sequencing/amplifying BioBrick parts (VF2)	tgccacctgacgtctaagaa	F		50	60C	20
BBa_G00101	Reverse primer for sequencing/amplifying BioBrick parts (VR)	attaccgcctttgagtgagc	R		50	60C	20
BBa_G00121	Reverse Primer to C0012	cagtcgggaaacctgtcgtg	R		60	64C	20
BBa_G00400	Forward Primer to C0040	cacctactactgatagtatgccgcc	F		52	76C	25
BBa_G00401	Reverse Primer to C0040	gcggacccactttcacatttaag	R		47	68C	23
BBa_G00700	Forward primer for I0500 (pBAD)	agatttatcgccagcagctc	F		50	60C	20
BBa_G00701	Reverse primer for I0500 (pBAD)	gccaacggttatctcgattt	R		45	58C	20
BBa_K3103007	pAMseq_f	tcatcggctcgtataatggt	forward		45	58C	20
BBa_K3103008	pAMseq_r	cttcaaaaaggccatccgtc	reverse		50	60C	20
BBa_K3464000	Forward Primer for the detection of ancestral allele of the rs4149056	tctgggtcatacatgtggatatatgt			38	72C	26
BBa_K3464001	Forward Primer for the detection of alternative allele of the rs4149056	tctgggtcatacatgtggatatatgc			42	74C	26
BBa_K3464002	Reverse Primer for the detection of the rs4149056	agcaaaggactattgaaagagtgaat			34	70C	26

Amplification of BioBrick parts

When working with BioBrick parts, a common operation is to verify the length of the cloned BioBrick part by amplifying the part using [http://openwetware.org/wiki/Colony_PCR colony PCR] and checking the length using [http://openwetware.org/wiki/Agarose_gel_electrophoresis agarose gel electrophoresis]. Most BioBrick plasmids have two pairs of primers that can be used for colony PCR. The first is the VF2 and VR primers, which flank the BioBrick cloning site but add approximately 200 nucletides to the PCR product length, depending on the vector. The second pair is the BioBrick-f and BioBrick-r primers which anneal to the BioBrick prefix and BioBrick suffix sequences, respectively.

Note that the VF2 and VR primers do not work well with all BioBrick parts. See notes on using the VF2 and VR primers.

More...

Name	Description	Sequence	Direction	Target	%GC	Tm	Length
BBa_G00100	Forward primer for sequencing/amplifying BioBrick parts (VF2)	tgccacctgacgtctaagaa	F		50	60C	20
BBa_G00101	Reverse primer for sequencing/amplifying BioBrick parts (VR)	attaccgcctttgagtgagc	R		50	60C	20
BBa_G00120	Forward Primer to C0012	gcttgctgcaactctctcaggg	F		59	70C	22
BBa_G00121	Reverse Primer to C0012	cagtcgggaaacctgtcgtg	R		60	64C	20
BBa_G00400	Forward Primer to C0040	cacctactactgatagtatgccgcc	F		52	76C	25
BBa_G00401	Reverse Primer to C0040	gcggacccactttcacatttaag	R		47	68C	23
BBa_G00500	Forward Primer to C0050	ggaaaacaatgcacgttaagcg	F		45	64C	22
BBa_G00501	Reverse Primer to C0050	ctgcctaatgaggactttggctag	R		50	72C	24
BBa_G00510	Forward Primer to C0051	gatttctgcatagccagacttggg	F		50	72C	24
BBa_G00511	Reverse Primer to C0051	cactgactagcgataactttccccac	R		50	78C	26
BBa_G00520	Forward Primer to C0052	ctggtcatagatggcggtcagaag	F		54	74C	24
BBa_G00521	Reverse Primer to C0052	gctacgaattttaccctcgcttcc	R		50	72C	24
BBa_G00530	Forward Primer to C0053	gaaggtgaaaacgaggccacattc	F		50	72C	24
BBa_G00531	Reverse Primer to C0053	gctggaagatttgcgagttttgc			47	68C	23
BBa_G00600	Forward Primer to C0060	gtacagcgtgctgaatatgaggc			52	70C	23
BBa_G00601	Reverse Primer to C0060	gcgattgatgccctggagtatg			54	68C	22
BBa_G00700	Forward primer for I0500 (pBAD)	agatttatcgccagcagctc	F		50	60C	20
BBa_G1004	Forward BioBrick prefix primer for amplifying BioBrick parts (BioBrick-f)	gtttcttcgaattcgcggccgcttctag	F		53	86C	28
BBa_G1005	Reverse BioBrick suffix primer for amplifying BioBrick parts (BioBrick-r)	gtttcttcctgcagcggccgctactagta	R		55	90C	29
BBa_K3464000	Forward Primer for the detection of ancestral allele of the rs4149056	tctgggtcatacatgtggatatatgt			38	72C	26
BBa_K3464001	Forward Primer for the detection of alternative allele of the rs4149056	tctgggtcatacatgtggatatatgc			42	74C	26
BBa_K3464002	Reverse Primer for the detection of the rs4149056	agcaaaggactattgaaagagtgaat			34	70C	26
BBa_K3658009	Batrachochytrium dendrobatidis (Bd) Polymerase Chain Reaction (PCR) forward primer	gccatatgtcacgagtcgaa			50	60C	20
BBa_K3658010	Batrachochytrium dendrobatidis (Bd) Polymerase Chain Reaction (PCR) reverse primer	tgtgatggacggggttgttta			47	62C	21
BBa_K3658011	Batrachochytrium salamandrivorans (Bsal) Polymerase Chain Reaction (PCR) forward primer	gggggttattaatagggagacga			47	68C	23
BBa_K3658012	Batrachochytrium salamandrivorans (Bsal) Polymerase Chain Reaction (PCR) reverse primer	gctccatctccccctcttcatccc			62	78C	24
BBa_K3658013	Batrachochytrium salamandrivorans (Bsal) Polymerase Chain Reaction (PCR) forward primer	agggagacgaaaaagatcaaga			40	62C	22
BBa_K3658014	Batrachochytrium salamandrivorans (Bsal) Polymerase Chain Reaction (PCR) reverse primer	tctgctccatctccccctcttc			59	70C	22
BBa_K3658015	LAMP FIP for Batrachochytrium dendrobatidis (Bd) ITS region	. . . ctttgtgaatcactcgcaacgatgaagaac			41	122C	43
BBa_K3658016	LAMP BIP for Batrachochytrium dendrobatidis (Bd) ITS region	. . . gcgttcaaagatctgtccagtcaattcgga			46	120C	41
BBa_K3658018	LAMP B3 for Batrachochytrium dendrobatidis (Bd) ITS region	ctgtcaaatatttttgacatggttc			32	66C	25
BBa_K3658019	LAMP BIP for Batrachochytrium dendrobatidis (Bd) ITS region	. . . gcaatgtgcgggttcatatctgtccagtca			45	122C	42
BBa_K3658022	LAMP B3 for Batrachochytrium dendrobatidis (Bd) ITS region	actactacttttaaaacctgtca			30	60C	23
BBa_K3658023	LAMP FIP for Batrachochytrium salamandrivorans (Bsal) ITS region	. . . ctctcgcaaacacagtggaataaaacaaca			43	118C	41
BBa_K3658024	LAMP BIP for Batrachochytrium salamandrivorans (Bsal) ITS region	. . . atttcgcactctacaaagtagagtgcaatg			40	132C	47
BBa_K3658025	LAMP F3 for Batrachochytrium salamandrivorans (Bsal) ITS region	attgtttggagtaaaatccca			33	56C	21
BBa_K3658026	LAMP B3 for Batrachochytrium salamandrivorans (Bsal) ITS region	ctattgattctcaaacaggca			38	58C	21
BBa_K3658027	LAMP FIP for Batrachochytrium salamandrivorans (Bsal) ITS region	. . . tggctctcgacacagtggaataaaacaaca			43	118C	41
BBa_K3658028	LAMP BIP for Batrachochytrium salamandrivorans (Bsal) ITS region	. . . tatcgcatttactctacaaagtagagtgca			37	124C	45
BBa_K3658029	Batrachochytrium dendrobatidis (Bd) ITS region qPCR forward primer	cgcaacgatgaagaacgcagcg			59	70C	22
BBa_K4235031	LIC Primer (Insert 5')	ccagcggcggtgccaccatgagggtc			73	90C	26
BBa_K4235032	LIC Primer (insert 3')	. . . ggagctagaattctttgtctttttccaaac			44	110C	38
BBa_K4235033	LIC Primer (vector 3')	ccgccgctggaggtttcggaccgagatc			67	94C	28
BBa_K4235034	LIC Primer (vector 5')	. . . ctcgggctcaggtaccgattacgatatccc			58	108C	34
BBa_K4235035	LIC Insert forward primer (5	. . . atatagttcatgcgcgtacttggcggacgc			47	124C	42
BBa_K4235036	LIC Insert reverse primer (3')	. . . tctcagagttcttagtttttttccaaactg			38	130C	47

Amplification of BioBrick plasmid backbones

When cloning and assembling BioBrick parts, you'll need DNA encoding a BioBrick plasmid backbone. One source of DNA is to miniprep plasmid DNA from cell culture. Alternatively, you can PCR amplify the backbone DNA using the Suffix-f and Prefix-r primers. PCR amplification of the plasmid backbone followed by restriction digest and gel purification has the advantage of greatly reducing contaminating intact plasmid DNA in your assembly ligation reaction.

Primers BBa_G1000 and BBa_G1001 are used in Jason Kelly's measurement kit. Primers BBa_G1002 and BBa_G1003 are used by Meagan Lizarazo at the Registry.

More...

Name	Description	Sequence	Direction	Target	%GC	Tm	Length
BBa_G1000	Forward primer for amplifying BioBrick plasmid backbones by PCR (Suffix-f)	tactagtagcggccgctgcag	F		61	68C	21
BBa_G1001	Reverse primer for amplifying BioBrick plasmid backbones by PCR (Prefix-r)	ctctagaagcggccgcgaattc	R		59	70C	22
BBa_G1002	Forward primer for amplifying BioBrick plasmid backbones by PCR (Suffix-f)	actagtagcggccgctgcag	F		65	66C	20
BBa_G1003	Reverse primer for amplifying BioBrick plasmid backbones by PCR (Prefix-r)	tctagatgcggccgcgaattc	R		57	66C	21
BBa_K3658000	Batrachochytrium dendrobatidis (Bd) ITS region RPA forward primer	. . . cgcaacgatgaagaacgcagcgaaatgcga			53	98C	32
BBa_K3658001	Batrachochytrium dendrobatidis (Bd) ITS region RPA reverse primer	. . . acatggttcatatctgtccagtcaattcgg			43	92C	32
BBa_K3658002	Batrachochytrium dendrobatidis (Bd) ITS region RPA reverse primer	. . . actcatttactactacttttaaaacctgtc			31	84C	32
BBa_K3658004	Batrachochytrium salamandrivorans (Bsal) ITS region RPA forward primer	. . . aatcccaacacagtggaataaaacaacaaa			31	84C	32
BBa_K3658005	Batrachochytrium salamandrivorans (Bsal) ITS region RPA reverse primer	. . . caaacaggcatactctacaaagtagagtgc			43	92C	32
BBa_K3658006	Batrachochytrium salamandrivorans (Bsal) ITS region RPA reverse primer	. . . catactctacaaagtagagtgcaatgtgcg			46	94C	32
BBa_K3658008	Batrachochytrium dendrobatidis (Bd) Polymerase Chain Reaction (PCR) reverse primer	cggggttgtttagacccact			55	62C	20
BBa_K4361201	BlcR BTB primer F1.1 D37R	atcctgcgcttggttgcgggctctccg			66	90C	27

Sequencing of long composite BioBrick parts

Composite BioBrick parts can quickly become too long to be completely sequenced by the VF2 and VR primers. In such cases, it can be useful to also sequence the BioBrick composite part via internal primers. For convenience, we include some primers that binds to common BioBrick reporters, such as the fluorescent proteins GFP, CFP and YFP.

More...

Name	Description	Sequence	Direction	Target	%GC	Tm	Length
BBa_G00200	Forward primer for sequencing composite parts; binds to CFP/YFP (BBa_E0020/22, BBa_E0030/32)	ccacaagttcagcgtgtccg			60	64C	20
BBa_G00201	Reverse primer for sequencing composite parts; binds to GFP (BBa_E0040)	acgtgtcttgtagttcccgtca	R		50	66C	22
BBa_K4706020	pSB1C30YIpHR-HO CUP1-GFP 2A SrpR-SV40NLS	. . . ttttttttctcttgaactcgacggatcata			0	11396C	5661
BBa_K863103	Cellulose binding Domain from Cellulomonas Fimi with Reporter GFP	. . . aaacatcaccatcaccatcacaccggttaa			4	2312C	1111
BBa_K863104	Cellulose binding Domain from C. Fimi with const. Promotor and GFP	. . . aaacatcaccatcaccatcacaccggttaa			3	2378C	1144
BBa_K863113	Cellulose binding Domain of C. cellulovorans cellulose binding protein with Reporter GFP	. . . aaacatcaccatcaccatcacaccggttaa			4	2240C	1075
BBa_K863114	CBD of C. cellulovorans cellulose binding protein gene with const. Promoter (J23100+J61101) and GFP	. . . aaacatcaccatcaccatcacaccggttaa			4	2324C	1117

Generic molecular biology vector primers

Historically, there are a set of primer sequences that are found in many of the common cloning vectors, such as the pUC vectors. For example, some of these primers bind to the T7, SP6 and T3 promoter sequences. Although most of these common primers aren't found in BioBrick plasmid backbones, we include them here for convenience.

More...

Name	Description	Sequence	Direction	Target	%GC	Tm	Length
BBa_G00103	M13-F (-20)	gtaaaacgacggccagt	F		52	52C	17
BBa_G00104	M13-R (-26)	caggaaacagctatgac	R		47	50C	17
BBa_G00105	M13-F (-40)	gttttcccagtcacgac	F		52	52C	17
BBa_G00106	M13-F (-46)	gccagggttttcccagtcacga	F		59	70C	22
BBa_G00107	M13-R (-46)	gagcggataacaatttcacacagg	R		45	70C	24
BBa_G00109	SP6 promoter sequencing primer, 24-mer	catacgatttaggtgacactatag	F		37	66C	24
BBa_G00110	T3 promoter sequencing primer, 17-mer	attaaccctcactaaag	F		35	46C	17
BBa_G00111	T3 promoter primer, 20-mer	attaaccctcactaaaggga	F		40	56C	20
BBa_G00112	T3 promoter sequencing primer, 24-mer	gcgcgaaattaaccctcactaaag	F		45	70C	24
BBa_G00113	T7 promoter sequencing primer, 20-mer	taatacgactcactataggg	F		40	56C	20
BBa_K863102	Cellulose binding Domain of C. Fimi Exoglucanase with T7, RBS, GS-Linker (Freiburg-Standard)	. . . ccctgcacggtcggcggcagcaccggttaa			18	886C	373
BBa_K863103	Cellulose binding Domain from Cellulomonas Fimi with Reporter GFP	. . . aaacatcaccatcaccatcacaccggttaa			4	2312C	1111
BBa_K863112	Cellulose binding domain of C. cellulovorans with T7, RBS, GS-Linker (Freiburg-Standard)	. . . gaatttggatttgcaggcagcaccggttaa			12	756C	337
BBa_K863113	Cellulose binding Domain of C. cellulovorans cellulose binding protein with Reporter GFP	. . . aaacatcaccatcaccatcacaccggttaa			4	2240C	1075