Part:BBa_K4016034
Trim21-Cry2-VK_CyclinE1
This composite part consists of truncated Trim21 (Part:BBa_K3396007) fused in the N-terminal, VK_cyclinE1 fused in the C-terminal and Cry2 in the middle. It is designed to generate cyclinE1 degradation with Part:BBa_K4016033 through Cry2-CIB1 interaction and VH_cyclinE1-VK_cyclinE1 folded conformation.
Usage and Biology
Our project this year is centered on the degradation of the proteins by blue light. Cryptochrome 2 (CRY2) is a blue light stimulated photoreceptor, when exposed to blue light, it would interact with CIB1 (Part:BBa K2980002). Functionally, it is used to fuse with other protein and bring them together into phase under light. This pair’s combination under blue light is used as our “On System”.
We focused on degrading Cyclins this year. Cyclin E is a critical cell cycle protein in the regulated progression of normal cells to replicate their DNA. Ectopic overexpression of cyclin E results in accelerated G1 progression, chromosome instability, and a reduced requirement for growth factors.[1] Dysregulated cyclin E expression is found in nearly all breast cancers examined. We suggest that our design provides new ideas for the treatment of diseases caused by CyclinE.
VH_cyclinE1 comes from hybridoma-rearranged heavy chain variable region gene in HE12 and HE172 hybridomas. By the same way, VK_cyclinE1 is produced from light chain variable region gene. We assumes that VH and VK will take on a folded conformation when they are adjacent in three-dimensional space, and thus recognize and bind to CyclinE1 tightly and specifically.
- Here is the mechanism of the recombined Trim21-Cry2-VK_CyclinE1:
1. The VK_CyclinE1 tagged with Cry2 combines VH_CyclinE1 and then combines with CyclinE1.
2. CIB1-VH_CyclinE1(see Part:BBa_K4016033) connect Trim21-Cry2-VK_CyclinE1 target through the VK_CyclinE1- VH_CyclinE1 and Cry2-CIB1 interaction.
3. CyclinE1 is degraded by ubiquitin-proteasome system recruited by Trim21.
Characterization
This part was validated through four ways: PCR, enzyme digestion, sequencing and functional test.
PCR
The PCR is performed with Green Taq Mix by Vazyme.
F-Prime：5’CACCATGGCTTCAGCAGCAG 3’
R-Prime：5’CCAAGCTTGAGATCAAAAGAT 3’
The PCR protocol is selected based on the Users Manuel. The Electrophoresis was performed on a 1% Agarose gel.
Enzyme Digestion
After the assembly the plasmid was transferred into the Competent E. coli DH5α). After culturing overnight in LB,we minipreped the plasmid for cutting. The cutting procedure was performed with Hind III EcoR I restriction endonuclease bought. The plasmid was cutted in a 20μL system at 37 ℃ for 2 hours. The Electrophoresis was performed on a 1％ Agarose glu.
Sequecing
The plasmid was sequenced correct.
Sequence and Features
- 10COMPATIBLE WITH RFC[10]
- 12INCOMPATIBLE WITH RFC[12]Illegal NheI site found at 204
- 21INCOMPATIBLE WITH RFC[21]Illegal BglII site found at 1195
Illegal BglII site found at 1654
Illegal BamHI site found at 2133 - 23COMPATIBLE WITH RFC[23]
- 25INCOMPATIBLE WITH RFC[25]Illegal NgoMIV site found at 161
Illegal AgeI site found at 1079
Illegal AgeI site found at 1808 - 1000INCOMPATIBLE WITH RFC[1000]Illegal BsaI site found at 1431
Illegal BsaI.rc site found at 840
Illegal SapI.rc site found at 948
Functional test
This composite part was constructed with Part:BBa_K4016033. Thus, the function of this composite part was validated together with BBa_K4016033.
Method
- 1.Cell transfection
(1)Seed HEK293T cells into 6-well cell culture plates.
(2)Culture for 16 h before transfection.
(3)Total plasmid mixes of 800 ng per well are mixed thoroughly in DMEM before a polyethylenimine (PEI) solution (1 mg/mL) is added into the plasmid mixture in a ratio of 1:5 (plasmid weight/PEI weight).
(4)The plasmid–PEI mixture is vortexed and incubated at room temperature for 15 min. The mixture is then added into the cells and incubated for at least 6 h.
(5)Cells are then changed into fresh medium and for 18h before subculture.
- 2.CCK8 assay
(1)Wash HEK293T cells in 6-well plate with PBS and trypsinize prior to resuspension in fresh complete medium in a 15 mL microcentrifuge tube.
(2)Dispense 100 μl of cell suspension (3000 cells/well) into a 96-well plate.
(3)Apply the experiment group with blue light stimulus (480nm, stimulate 2 seconds with a 58 second-interval) for 24/48/72 hours in a incubator (at 37°C, 5% CO2).
(4)In 24th/48th/72th hour, dilute 10 µL CCK-8 solution to 100 µL, add 100 μl diluted CCK-8 solution to each well of the plate.
(5)Incubate the plate for 2 hours in the incubator.
(6)Measure the absorbance at 450 nm using a microplate reader
Figure2. Experimental validation approach
Result
To demonstrate Trim21-Cry2-VK_CyclinE1 can interact with CIB1-VH_CyclinE1 when stimulated with blue light and then result in Cyclin D degradation，we did CCK-8 assay. The result showed a significant decrease of 450nm absorbance compared to the control group (transfected with pcDNA3.1), indacating that in the experimental group, the growth of cells was inhibited. The result successfully proved our system can work as we expected.
Figure3. Evaluation of the Trim21-Cry2-VK_CyclinE1. CCK-8 assay showing the 450nm Absorbance of Hek-293T cells transfected with pcDNA3.1(control group) and Trim21-Cry2-VK_CyclinE1+CIB1-VH_CyclinE1(experimental group). This test takes 20min as the interval time.
Reference
[1]Randall W. Strube , Si-Yi Chen, et al. Characterization of anti-cyclin E single-chain Fv antibodies and intrabodies in breast cancer cells: enhanced intracellular stability of novel sFv–Fc intrabodies[J].Journal of Immunological Methods, 2002, 263: 149–167.
| None |