Part:BBa_K4016033
CIB1-VH_CyclinE1
This composite part consists of truncated Trim21 (Part:BBa_K3396007) fused in the N-terminal, VK_cyclinE1 fused in the C-terminal and Cry2 in the middle. It is designed to generate cyclinE1 degradation with Part:BBa_K4016034 through Cry2-CIB1 interaction and VH_cyclinE1-VK_cyclinE1 folded conformation.
Usage and Biology
Our project this year is centered on the degradation of the cyclins by blue light. Cryptochrome 2 (CRY2) is a blue light stimulated photoreceptor, when exposed to blue light, it would interact with CIB1 (Part:BBa K2980002). Functionally, it is used to fuse with other protein and bring them together into phase under light. This pair’s combination under blue light is used as our “On System”.
We focused on degrading Cyclins this year. Cyclin E is a critical cell cycle protein in the regulated progression of normal cells to replicate their DNA. Ectopic overexpression of cyclin E results in accelerated G1 progression, chromosome instability, and a reduced requirement for growth factors.[1] Dysregulated cyclin E expression is found in nearly all breast cancers examined.
VH_cyclinE1 comes from hybridoma-rearranged heavy chain variable region gene in HE12 and HE172 hybridomas. By the same way, VK_cyclinE1 is produced from light chain variable region gene. We assumes that VH and VK will take on a folded conformation when they are adjacent in three-dimensional space, and thus recognize and bind to CyclinE1 tightly and specifically.
- Here is the mechanism of the recombined CIB1-VH-CyclinE1:
1. The VH_CyclinE1 tagged with CIB1 combines VK_CyclinE1 and then combines with CyclinE1.
2. Trim21-Cry2-VK_CyclinE1 (see Part:BBa_K4016034) connect CIB1-VH-CyclinE1 target through the VH_CyclinE1-VK_CyclinE1 and CIB1- Cry2 interaction.
3. CyclinE1 is degraded by ubiquitin-proteasome system recruited by Trim21.
Characterization
This part was validated through four ways: PCR, enzyme digestion, sequencing and functional test.
PCR
The PCR is performed with Green Taq Mix by Vazyme.
F-Prime：5’CTAGCGTTTAAACTTAAGCTTGCCACCATGGGTAATGGAGCCATCGGCGGCGA 3’
R-Prime：5’TGGATATCTGCAGAATTCTTACGCGGACACTGTCACTAATG 3’
The PCR protocol is selected based on the Users Manuel. The Electrophoresis was performed on a 1% Agarose gel.
Enzyme Digestion
After the assembly the plasmid was transferred into the Competent E. coli DH5α). After culturing overnight in LB,we minipreped the plasmid for cutting. The cutting procedure was performed with Hind III EcoR I restriction endonuclease bought. The plasmid was cutted in a 20μL system at 37 ℃ for 2 hours. The Electrophoresis was performed on a 1％ Agarose glu.
Sequecing
The plasmid was sequenced correct.
Sequence and Features
- 10COMPATIBLE WITH RFC[10]
- 12COMPATIBLE WITH RFC[12]
- 21COMPATIBLE WITH RFC[21]
- 23COMPATIBLE WITH RFC[23]
- 25INCOMPATIBLE WITH RFC[25]Illegal NgoMIV site found at 112
- 1000COMPATIBLE WITH RFC[1000]
Functional test
This composite part was constructed with Part:BBa_K4016034. Thus, the function of this composite part was validated together with BBa_K4016034.
Method
- CCK-8 assay
For functional validation, we used the Blue Light to induce the interaction between CIB1 and CRY2. We co-transfect BBa_K4016034 and BBa_K4016035 into cells. Using CCK8 can detect the number of live cells. For such assay, Hek293T cells is washed with PBS and trypsinized prior to resuspension in fresh complete medium in a 1.5 mL microcentrifuge tube. Then dispense 100 μl of cell suspension (2500 cells/well) in a 96-well plate. Then pre-incubate the plates for 12/24/48/72 hours in a humidified incubator with our Blue Light Device in it. In 12th/24th/48th/72th hour, dilute 10 µL CCK-8 solution to 100 µLadd 100 μl diluted CCK-8 solution to each well of the plate. Then incubate the plate for 2 hours in the incubator. Finally, measure the absorbance at 450 nm using a microplate reader.
Figure2. Experimental validation approach
Result
To demonstrate CIB1-VH_CyclinE1 can interact with Trim21-Cry2-VK_CyclinE1 when stimulated with blue light and then result in Cyclin D degradation，we did CCK-8 assay. The result showed a significant decrease of 450nm absorbance compared to the control group (transfected with pcDNA3.1), indacating that in the experimental group, the growth of cells was inhibited. The result successfully proved our system can work as we expected
Figure3. Evaluation of the CIB1-VH_CyclinE1. CCK-8 assay showing the 450nm Absorbance of HEK-293T cells transfected with pcDNA3.1(control group) and Trim21-Cry2-VK_CyclinE1+CIB1-VH_CyclinE1(experimental group). This test takes 20min as the interval time.
Reference
[1]Randall W. Strube , Si-Yi Chen, et al. Characterization of anti-cyclin E single-chain Fv antibodies and intrabodies in breast cancer cells: enhanced intracellular stability of novel sFv–Fc intrabodies[J].Journal of Immunological Methods, 2002, 263: 149–167.
| None |