Part:BBa_K2924005

guideRNA from long-chain-fatty-acid CoA ligase

long-chain-fatty-acid CoA ligase slr1609 guide RNA of Synechocystis sp.

Usage and Biology

This part contains the long-chain-fatty-acid CoA ligase guide RNA of Synechocystis sp. PCC 6803. It was used for an induced knock-down of slr1609 with a CRISPRi/dCas9-system, which was kindly provided by Yao et al. (2015)⁴. The long-chain-fatty-acid CoA ligase can be found under the UniProt ID: P73004_SYNY3¹ and is involved in fatty acid synthesis, degradation, and metabolism². The gene is positioned in the genome at 487287 - 489377 (2091 bp) bases ². The guide RNA was obtained by using the CRISPR guide from benchling³. The sgRNA in the gene is located at 201-220 bp in the + strand (Fig. 1). The sequence of the sgRNA is CCATTCCATCCATTGCCTGG, has anOn-Target Score of 72.2 and an Off-Target Score of 50.0.

Fig. 1: Position of sgRNA (orange) in the long-chain-fatty-acid CoA ligase gene.

Fig. 2: Reaction catalyzed by long-chain-fatty-acid CoA ligase

The long-chain-fatty-acid CoA ligase catalyzes the pre-step reaction for β-oxidation of long-chain fatty acids by ligating coenzyme A to a fatty acid under consumption of a lot of energy in the form of ATP ⁵. These enzyme is present in all organisms from bacteria to human. Its mechanism is well known and can be divided in several steps.

Step one: One ATP molecule and a long-chain fatty acid enter the active site of the enzyme. The negatively charged oxygen of the fatty acid attacks the ATP and forms a AMP-fatty acid intermediate. Step two: Pyrophosphate leaves the active site. Step three: Coenzyme A enters the active site and forms with the AMP-fatty acid intermediate another one, the AMP-fatty acid-CoA. Step four: At the end, fatty acid-CoA and AMP are released out of the active site (Fig. 2)⁵.

This enzyme dimerizes and is then able to bind ATP at the C-terminal and fatty acid at the binding tunnel of the N-terminal, which can now interact with each other by different interaction between C- and N-terminal ⁵.

The short guide RNA (sgRNA) was cloned into a vector containing a neutral site of Synechocystis sp. PCC 6803. That’s a homologous sequence of its genome to ensure a knock-in into the genome (Fig. 3)⁴.

Due to this knock-in containing a resistance for antibiotic and the sgRNA, we can down-regulate the target enzyme with a CRISPRi/dCas9 - system ⁴. This system is induced by anhydrotetracycline (aTc), which activates the synthesis of the dCas9, which is then binding to the sgRNA. These complex is able to bind complementary to the targeted enzyme and stops the transcription of it (Fig. 4).

Fig. 3: Scheme of a knock-in as a consequence of homologous recombination in Synechocystis.

Fig. 4: Scheme of function of the CRISPRi/dCas9 - system. The dCas9 (yellow) binds with the sgRNA to the complementary DNA strand and inhibits the transcription by RNA polymerase II (blue).

Sequence and Features

Assembly Compatibility:

• 10
  COMPATIBLE WITH RFC[10]
• 12
  COMPATIBLE WITH RFC[12]
• 21
  COMPATIBLE WITH RFC[21]
• 23
  COMPATIBLE WITH RFC[23]
• 25
  COMPATIBLE WITH RFC[25]
• 1000
  COMPATIBLE WITH RFC[1000]

Characterization

For testing the created system the cultures were induced with aTc and the growth rates were documented for few days. To check the transcriptional activity on the targeted gene, a qPCR was performed from pelletized cultures. Finally, the varying percentage yields of fatty acids were measured via gas chromatography-mass spectrometry.

Proof of concept

Fig. 5: Fluorescence measurement of the mVenus knock-down (KD) strain in the plate reader 24 h after induction with 500 nM aTc (red) or 100% EtOH (negative control, blue). 2 biological and 3 technical replicates were cultured in 6-well plates.

This concept has been tested with the fluorescent protein mVenus. The sgRNA was designed using the “CRISPR Guides” tool on benchling³ by choosing suitable candidate sgRNAs, which binds at the start of mVenus and cloned it via homologous recombination into the genome of Synechocystis sp. PCC 6803. Furthermore, this Synechocystis sp. PCC 6803 was transformed with a plasmid containing the P_cpc560 BBa_K2924000 and the mVenus CDS BBa_K2924035.

Synechocystis sp. WT and Synechocystis sp. PCC 6803 with sgRNA_mVenus and pSHDY_P_cpc560_mVenus colonies were inoculated in BG11 medium with 20 µg/ml spectinomycin, 25 µg/ml kanamycin and 10 µg/ml chloramphenicol at 30°C and shaked with specific light and CO₂ conditions using 6 well plates. After 2 days of incubation, some cultures were induced with 500 nM aTc or with 100% EtOH as a control with the same amounts added. After 24 hours, the fluorescences were measured using a plate reader. Each sample was measured in biological duplicates, which are then tested in technically triplicates (Fig. 5).

As in Fig. 5 can be seen, the overall fluorescence decreased after induction with the inducer aTc. But in comparison to the empty vector control (EVC), fluorescence can be clearly measured. This proves our concept of down-regulating a protein or enzyme without abolishing the functions completely.

Ligase knock-down characterization

Fig. 6: Growth curve of <i>Synechocystis sp. PCC 6803 transformants after induction with 500 nM aTc over about 120 h.</i>

Fig. 7: The relative expression of different clones containing the same sgRNA for long-chain-fatty-acid CoA ligase. Control= strain expressing the long-chain-fatty-acid CoA ligase without induction of the sgRNA. Clones= strain expressing the long-chain-fatty-acid CoA ligase with induction of the sgRNA targeting the gene.

After inoculation and incubation of Synechocystis sp. PCC 6803 transformants with sgRNA_ligase BBa_K2924005 in BG11, were diluted to an OD₇₅₀= 0.45, a few days later induced with an appropriate amount of 500 nM aTc while the following antibiotics were added: 20 µg/ml spectinomycin and 25 µg/ml kanamycin. The cultures were incubated at 30°C and shaken under light and specific CO₂ conditions.

The growth rate of Synechocystis sp. PCC 6803 transformants was not affected by the knockdown of long-chain-fatty-acid CoA ligase (Fig. 6).

The transcription of genes can be detected by a qPCR. Therefore, it can be used to validate the level of the transcription of a gene of interest due to specific primer. In this case, the knockdown target long-chain-fatty-acid CoA ligase and the housekeeping gene for technical faults (rnpB) were analysed. The cultures were induced with aTc [500nM] and after 24 h 1.5 ml of the cultures were pelletized to perform a qPCR (Fig. 7).

The expression levels for all of the transformants clones are lower as the control (Fig. 7). This is caused by the CRISPRi/dCas9-Knockdown system.

GC-MS

For the fatty acid composition analysis in Synechocystis sp., the transformants and a control were grown under the same grow conditions. 4 optical density units of cells, usually, an equivalent of 4 ml cells at OD₆₀₀ = 1, were isolated and used for extraction and derivatization of fatty acids. The extract was used for gas chromatography-mass spectrometry (GC-MS) (Fig. 8).

Fig. 8: Effect of CRISPRi/dCas9-system with the sgRNA of long-chain-fatty-acid CoA ligase on the fatty acid profile and yield of different fatty acids. The control resembles a Synechocystis strain without down regulation. The clones resemble Synechocystis strains with downregulated long-chain-fatty-acid CoA ligase.

As shown in Fig. 8, the transformants differ from the control from a length of C16:3 upwards. C18:0 and C18:1 fatty acids show a slightly higher fatty acid yield in both cases. This may be due to the knockdown of the long-chain-fatty-acid CoA ligase.

References

[1]: https://www.uniprot.org/uniprot/P73004

[2]: https://www.genome.jp/dbget-bin/www_bget?syn:slr1609

[3]: Benchling [Biology Software]. (2019). Retrieved from https://benchling.com.

[4]:Yao, L., Cengic, I., Anfelt, J., & Hudson, E. P. (2015). Multiple gene repression in cyanobacteria using CRISPRi. ACS synthetic biology, 5(3), 207-212.

[5]: Hisanaga, Y., Ago, H., Nakagawa, N., Hamada, K., Ida, K., Yamamoto, M., Hori, T., Arii, Y., Sugahara, M., Kuramitsu, S., Yokoyama, S., & Miyano, M. (2004). Structural basis of the substrate-specific two-step catalysis of long chain fatty acyl-CoA synthetase dimer. Journal of Biological Chemistry, 279(30), 31717-31726.