Part:BBa_K2842666
Golden Gate compatible system with blue-white screening
| Flexible Cloning System | |
|---|---|
| Function | Standardised blue-white screening |
| Use in | E. coli cells |
| Chassis Tested | DH5α cells |
| Abstraction Hierarchy | Composite Device |
| Related Device | BBa_I732902 |
| RFC standard | RFC10,RFC12,RFC21,RFC23 & RFC25 compatible |
| Backbone | pSB1C3 |
| Submitted by | [http://2018.igem.org/Team:UCL UCL iGEM 2018] |
This BioBrick-compatible standard with improved flexibility enables the integration of conventional cloning methods into iGEM’s workflow. Once inserted into a backbone, BioBrick2.0 allows cloning through Golden Gate assembly and Gibson assembly. At the same time, our construct has a LacZ reporter which can be used to screen plates for successful colonies. BioBrick2.0 is a new standard which can facilitate the cloning process for future iGEM teams.
Blue-White Screening
The lacZ reporter allows for blue-white screening. It can be displaced by compatible constructs through BioBrick assembly, Golden Gate or Gibson assembly. Blue-white screening is based on the inability of commercial E. coli to metabolise galactose or structurally similar substrates like X-Gal because of a lacZ deletion mutation. Once lacZα is provided through a plasmid, X-Gal can be metabolised to an easily detectable blue compound. This screening can also be used for subsequent cloning where the displacement of lacZ results in white colonies.
Compatibility
For Golden Gate assembly, BsaI cut sites and defined overhangs were added. The BsaI overhangs are based on Vladimir et al. 2018 [1]. CCAA was chosen for upstream and ACGG for downstream. For Gibson assembly, a defined area of homology was designed. BsaI can be used to open the plasmid, removing the reporter and exposing the Gibson overhangs.
Digesting BioBrick2.0 with BsaI cleaves lacZ so it can be replaced by the insert of interest. As it can be seen on the gel, digestion with both BsaI and EcoRI+PstI is possible.
Comparison of cloning efficiency between Golden Gate and BioBrick assembly
Intein Passenger BBa_K2842669 was cloned into our BioBrick2.0 in pSB1C3 using BioBrick assembly and Golden Gate assembly. The same amount of ligation product was transformed into NEB competent E. coli DH5α (high efficiency) and plated onto LB Lennox L agar plates containing 20 μg/ml X-Gal. Ten- and hundred-fold dilutions were carried out to allow an accurate count of colony forming units. A comparison between the average number of blue and white colonies can be seen in the table below. The total number of colonies was similar for the two different cloning techniques. However the ratio between white and blue colonies, indicating how successful cloning was, is higher for Golden Gate cloning. Therefore, our proposed BioBrick2.0 offers a valuable alternative to BioBrick assembly.
| CFU Comparison between BioBrick assembly and Golden Gate | ||
|---|---|---|
| Part | BBa_K2842666 | |
| Cloning Method | BioBrick Assembly | Golden Gate |
| Average number of blue colonies | 587 | 313 |
| Average number of white colonies | 170 | 448 |
| Ratio between average number of white and average number of blue colonies |
0.3 | 1.4 |
Prefixes
Golden Gate:
Forward overhang: 5'- AAAGGTCTCACCAA -3'
Reverse overhang: 5'- AAAGGTCTCACCGT -3'
Gibson:
Forward overhang: 5'- GCTTCTACAAACGCGGCTTCTT -3'
Reverse overhang: 5'- ACGACGCCGGTTACTACATTGA -3'
Primer Design
The following primers can be used to amplify the part:
Forward: 5'- ACGAACCAGCGATAAGGGACAA -3'
Reverse: 5'- TTGGAAGAACGTGGATCTCCCC -3'
References
[1] Vladimir P, Ong JL, Kucera RB, Langhorst BW, Bilotti K, Pryor JM, et al. Optimization of Golden Gate assembly through application of ligation sequence-dependent fidelity and bias profiling. bioRxiv [Internet]. 2018 May 15 [cited 2018 Oct 16];322297. Available from: https://www.biorxiv.org/content/early/2018/05/15/322297
-
Sequence and Features
- 10COMPATIBLE WITH RFC[10]
- 12COMPATIBLE WITH RFC[12]
- 21COMPATIBLE WITH RFC[21]
- 23COMPATIBLE WITH RFC[23]
- 25COMPATIBLE WITH RFC[25]
- 1000INCOMPATIBLE WITH RFC[1000]Illegal BsaI site found at 647
Illegal BsaI.rc site found at 28
| None |