Device

Part:BBa_K1150039

Designed by: Ilona Blank   Group: iGEM13_Freiburg   (2013-09-17)

uniCAS RNAimer to target VEGF4


RNAimer (VEGF4 target)
Function Targeting VEGF4 with Cas9
Use in Mammalians
RFC standard RFC 25
Backbone pSB1C3
Submitted by Freiburg 2013

This device derived from BBa_K1150034 can be used in combination with all devices with dCas9. It contains a DNA sequence coding for a crRNA that binds complementary to VEGF4 target (GTGAGTGTGTGCGTGTGGGGTTGAGGGCGT).

For more information about dCas9 devices klick here.

Biology and Usage

Freiburg 2013 used this plasmid to test the efficiency of target VEGF4 by activating or repressing a SEAP reporter gene.

Sequence and Features


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    INCOMPATIBLE WITH RFC[21]
    Illegal BglII site found at 224
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    COMPATIBLE WITH RFC[25]
  • 1000
    INCOMPATIBLE WITH RFC[1000]
    Illegal BsaI.rc site found at 216


Functional Parameters: Austin_UTexas

BBa_K1150039 parameters

Burden Imposed by this Part:

Burden Value: -1.0 ± 3.8%

Burden is the percent reduction in the growth rate of E. coli cells transformed with a plasmid containing this BioBrick (± values are 95% confidence limits). This BioBrick did not exhibit a burden that was significantly greater than zero (i.e., it appears to have little to no impact on growth). Therefore, users can depend on this part to remain stable for many bacterial cell divisions and in large culture volumes. Refer to any one of the BBa_K3174002 - BBa_K3174007 pages for more information on the methods, an explanation of the sources of burden, and other conclusions from a large-scale measurement project conducted by the 2019 Austin_UTexas team.

This functional parameter was added by the 2020 Austin_UTexas team.

Literature

[edit]
Categories
Parameters
None