Part:BBa_K4197011

OmpA_DARPin

Gene fusion to express the DARPin-sfGFP fusion protein at the surface of E.coli.

Introduction

This part is composed of the gene coding for the DARPin E2_79 protein (see BBa_K4197019) in fusion with the lpp-ompA-N gene (see BBa_K1694002). This part was designed to link IgE at the surface of E. coli.

The DARPin E2_79 protein has a strong affinity for the constant part of IgE (Baumann et al., 2010). It was merged to the membrane protein Lpp-OmpA-N of E. coli (see BBa_K1694002) to display the DARPin on the surface of E. coli. This lipoprotein is the most abundant in the membrane of E. coli with 100,000 copies per cell (Ortiz-Suarez and al. 2016) and is often used to display proteins on the surface of bacteria (Yang and al. 2016).

Construction

The brick was contructed from the BBa_K4197010 part. To delete the sfGFP fragment, pET-21 b (+)_OmpA_DARPin-sfGFP was linearized by PCR using the high fidelity Phusion DNA polymerase with primers FORWARD: tggtgatgcagtttctgcaaaatttccgcc and REVERSE: gaaactgcatcaccatcaccatcacc, which excluded the sfGFP sequence. The expected size of the amplicon was 6202 bp (Figure 1). Amplification product sizes were checked on EtBr stained agarose gel. Amplicons were further purified from the gel.

Figure 1: pET-21 b (+)_OmpA_DARPin linearized. The expected size of the amplicons was 6202 bp. PCR amplicon sizes were checked with agarose electrophoresis gel and revealed with EtBr. A theoretical gel is presented on the left and the NEB 1 kb DNA ladder is used for the experimental gels. (note that a different ladder is presented on the theoretical gel).

The linearized plasmid was then recircularized by In-Fusion to form the pET-21 b (+)_OmpA_DARPin vector. pET-21 b (+)_OmpA_DARPin was transformed into E. coli Stellar competent cells. Transformants were selected on LB-ampicillin plates. Presence of the insert was checked with a colony PCR using the primers FORWARD: ggttatgctagttattgctcagc and REVERSE: ccgaaacaagcgctcatgagc. Expected size of the fragment were 1162 bp (Figure 2). Expected size of positive colonies was 1885 bp (Figure 2). Plasmids colonies containing the insert were extracted by Miniprep.

Figure 2: identifying the strains that bear pET21 b (+)_Ompa_DARPin by colony PCR. The expected size of the amplicon was 1162 bp. Only two clones were not positive (D.3 and D.6). All clones were compared to a control with a linearized plasmid still containing the sfGFP fragment. PCR amplicon sizes were checked with agarose electrophoresis gel and revealed with EtBr. A theoretical gel is presented on the left and the NEB 1 kb DNA ladder is used for the experimental gels (note that a different ladder is presented on the theoretical gel).

We then tried to assess the expression and functionality of the DARPin, i.e. its capacity to bind IgE. Two experiments were conducted for this purpose, but none of them showed exploitable results (data not shown). As the DARPin protein was HIS-tagged, we first tried to detect it by binding a fluorescent anti-HIS-tag IgG to the cell membrane and measuring fluorescence. No fluorescence was observed, so we could not conclude if the protein was expressed at the membrane, especially without a positive control. We then tried to assess the functionality of the DARPin by binding an IgE to it (the DARPin being able to link to the constant part of IgE), and then binding a fluorescent anti-IgE IgG to the complex. No fluorescence was observed. Without a positive control, we cannot conclude between an incorrect exposition of the protein (not facing the outer surface), or a mere problem during the setup of the experiment.

Xxxxxxxxx

Xxxxxxxxxxxxx

Figure 2: Xxxxxxxxxxxxx Xxxxxxxxxxxxx.

titre 2

Titre 3

Xxxxxxxxxx

• Forward : TAAGAAGGAGATATACCATGGCGGAAGCGGGTATCACC
• Reverse : CTCGAGTGCGGCCGCAAGCTTCGGATCGTCCTATGATGGAGG

Xxxxxxxxxx

• CForward : CGCGGCCGCTTCTAGAGCGGAAGCGGGTATCACC
• Reverse : AGCGGCCGCTACTAGTCGGATCGTCCTATGATGGAGG

titre 3

Titre 4

Xxxxxx

Titre 4

xxxxxxx

Titre 2

Xxxxxx

References

1. Morag E, Lapidot A, Govorko D, Lamed R, Wilchek M, Bayer EA, Shoham Y: Expression, purification, and characterization of the cellulose-binding domain of the scaffoldin subunit from the cellulosome of Clostridium thermocellum. Applied and Environmental Microbiology 1995, 61:1980-1986.
2. Nogueira ES, Schleier T, Durrenberger M, Ballmer-Hofer K, Ward TR, Jaussi R: High-level secretion of recombinant full-length streptavidin in Pichia pastoris and its application to enantioselective catalysis. Protein Expr Purif 2014, 93:54-62. DOI: 10.1016/j.pep.2013.10.015.
3. Young TS, Schultz PG: Beyond the canonical 20 amino acids: expanding the genetic lexicon. J Biol Chem 2010, 285:11039-11044. DOI: 10.1074/jbc.R109.091306.

Sequence and Features

Assembly Compatibility:

• 10
  INCOMPATIBLE WITH RFC[10]

  Illegal EcoRI site found at 130
  Illegal XbaI site found at 47
  
• 12
  INCOMPATIBLE WITH RFC[12]

  Illegal EcoRI site found at 130
  Illegal NheI site found at 92
  
• 21
  INCOMPATIBLE WITH RFC[21]

  Illegal EcoRI site found at 130
  Illegal BamHI site found at 124
  
• 23
  INCOMPATIBLE WITH RFC[23]

  Illegal EcoRI site found at 130
  Illegal XbaI site found at 47
  
• 25
  INCOMPATIBLE WITH RFC[25]

  Illegal EcoRI site found at 130
  Illegal XbaI site found at 47
  Illegal AgeI site found at 832
  
• 1000
  COMPATIBLE WITH RFC[1000]