Part:BBa_K4197011
OmpA_DARPin
Gene fusion to express the DARPin-sfGFP fusion protein at the surface of E.coli.
Introduction
This part is composed of the gene coding for the DARPin E2_79 protein (see BBa_K4197019) in fusion with the lpp-ompA-N gene (see BBa_K1694002). This part was designed to link IgE at the surface of E. coli.
The DARPin E2_79 protein has a strong affinity for the constant part of IgE (Baumann et al., 2010). It was merged to the membrane protein Lpp-OmpA-N of E. coli (see BBa_K1694002) to display the DARPin on the surface of E. coli. This lipoprotein is the most abundant in the membrane of E. coli with 100,000 copies per cell (Ortiz-Suarez and al. 2016) and is often used to display proteins on the surface of bacteria (Yang and al. 2016).
Construction
The linearized plasmid was then recircularized by In-Fusion to form the pET-21 b (+)_OmpA_DARPin vector. pET-21 b (+)_OmpA_DARPin was transformed into E. coli Stellar competent cells. Transformants were selected on LB-ampicillin plates. Presence of the insert was checked with a colony PCR using the primers FORWARD: ggttatgctagttattgctcagc and REVERSE: ccgaaacaagcgctcatgagc. Expected size of the fragment were 1162 bp (Figure 2). Expected size of positive colonies was 1885 bp (Figure 2). Plasmids colonies containing the insert were extracted by Miniprep. We then tried to assess the expression and functionality of the DARPin, i.e. its capacity to bind IgE. Two experiments were conducted for this purpose, but none of them showed exploitable results (data not shown). As the DARPin protein was HIS-tagged, we first tried to detect it by binding a fluorescent anti-HIS-tag IgG to the cell membrane and measuring fluorescence. No fluorescence was observed, so we could not conclude if the protein was expressed at the membrane, especially without a positive control. We then tried to assess the functionality of the DARPin by binding an IgE to it (the DARPin being able to link to the constant part of IgE), and then binding a fluorescent anti-IgE IgG to the complex. No fluorescence was observed. Without a positive control, we cannot conclude between an incorrect exposition of the protein (not facing the outer surface), or a mere problem during the setup of the experiment.Xxxxxxxxx
Xxxxxxxxxxxxx
titre 2
Titre 3
Xxxxxxxxxx
- Forward : TAAGAAGGAGATATACCATGGCGGAAGCGGGTATCACC
- Reverse : CTCGAGTGCGGCCGCAAGCTTCGGATCGTCCTATGATGGAGG
Xxxxxxxxxx
- CForward : CGCGGCCGCTTCTAGAGCGGAAGCGGGTATCACC
- Reverse : AGCGGCCGCTACTAGTCGGATCGTCCTATGATGGAGG
titre 3
Titre 4
Xxxxxx
Titre 4
xxxxxxx
Titre 2
Xxxxxx
References
- Morag E, Lapidot A, Govorko D, Lamed R, Wilchek M, Bayer EA, Shoham Y: Expression, purification, and characterization of the cellulose-binding domain of the scaffoldin subunit from the cellulosome of Clostridium thermocellum. Applied and Environmental Microbiology 1995, 61:1980-1986.
- Nogueira ES, Schleier T, Durrenberger M, Ballmer-Hofer K, Ward TR, Jaussi R: High-level secretion of recombinant full-length streptavidin in Pichia pastoris and its application to enantioselective catalysis. Protein Expr Purif 2014, 93:54-62. DOI: 10.1016/j.pep.2013.10.015.
- Young TS, Schultz PG: Beyond the canonical 20 amino acids: expanding the genetic lexicon. J Biol Chem 2010, 285:11039-11044. DOI: 10.1074/jbc.R109.091306.
Sequence and Features
- 10INCOMPATIBLE WITH RFC[10]Illegal EcoRI site found at 130
Illegal XbaI site found at 47 - 12INCOMPATIBLE WITH RFC[12]Illegal EcoRI site found at 130
Illegal NheI site found at 92 - 21INCOMPATIBLE WITH RFC[21]Illegal EcoRI site found at 130
Illegal BamHI site found at 124 - 23INCOMPATIBLE WITH RFC[23]Illegal EcoRI site found at 130
Illegal XbaI site found at 47 - 25INCOMPATIBLE WITH RFC[25]Illegal EcoRI site found at 130
Illegal XbaI site found at 47
Illegal AgeI site found at 832 - 1000COMPATIBLE WITH RFC[1000]
None |