Part:BBa_K4047000
primerT/TF_tal- forward
Sequence and Features
- 10INCOMPATIBLE WITH RFC[10]Illegal EcoRI site found at 20
- 12INCOMPATIBLE WITH RFC[12]Illegal EcoRI site found at 20
- 21INCOMPATIBLE WITH RFC[21]Illegal EcoRI site found at 20
- 23INCOMPATIBLE WITH RFC[23]Illegal EcoRI site found at 20
- 25INCOMPATIBLE WITH RFC[25]Illegal EcoRI site found at 20
- 1000COMPATIBLE WITH RFC[1000]
This is the forward primer for transaldolase. The overlap sequence (acacaggaaacagaccatgg) allows proper Gibson assembly with the pGEM-tal backbone. The intermediate aattc sequence preserves the EcoRI restriction digest site for confirmation testing. The annealing portion (ATGGCAGCGAATTTACTCGAAC) allows annealing to the WT S. elongatus PCC 7942 genome for proper amplification.
This was also the forward primer for amplification of transaldolase prior to the assembly of pGEM-tal+fbp. Once again, the overlap sequence (red) allows proper Gibson assembly with the pGEM-tal+fbp backbone. The annealing portion (all caps) allows annealing to the WT S. elongatus PCC 7942 genome for proper amplification.
None |