Promoters/Catalog/B. subtilis/Positive

The promoters here are B. subtilis promoters that are positively regulated meaning that increased levels of at least one transcription factor (other than the sigma factor) will increase the activity of these promoters.

Positively regulated B. subtilis σ^A promoters

This section lists promoters that are recognized by B. subtilis σ^A RNAP. σ^A is the major B. subtilis sigma factor so there should be RNAP present to transcribe these promoters under most growth conditions (although maximally during exponential growth).

More...

Name	Description	Promoter Sequence	Positive Regulators	Negative Regulators	Length	Doc	Status
BBa_K090504	Gram-Positive Strong Constitutive Promoter	. . . acatgggaaaactgtatgtatttgatcctc			239	2275	It's complicated

Positively regulated B. subtilis σ^B promoters

This section lists promoters that are recognized by B. subtilis σ^B RNAP. σ^B is the major stationary phase E. coli sigma factor. Use these promoters when you want high promoter activity during stationary phase or during starvation.

There are no parts for this table