Promoters/Catalog/B. subtilis/Constitutive

All the promoters on this page are B. subtilis promoters that are constitutive meaning that the activity of these promoters should only be regulated by the levels of RNA polymerase and the appropriate σ factor.

Constitutive B. subtilis σ^A promoters

This section lists promoters that are recognized by B. subtilis σ^A RNAP. σ^A is the major B. subtilis sigma factor so there should be RNAP present to transcribe these promoters under most growth conditions (although maximally during exponential growth).

More...

Name	Description	Promoter Sequence	Positive Regulators	Negative Regulators	Length	Doc	Status
BBa_K143012	Promoter veg a constitutive promoter for B. subtilis	. . . aaaaatgggctcgtgttgtacaataaatgt			97	6561	In stock
BBa_K143013	Promoter 43 a constitutive promoter for B. subtilis	. . . aaaaaaagcgcgcgattatgtaaaatataa			56	11873	Not in stock
BBa_K780003	Strong constitutive promoter for Bacillus subtilis	. . . aattgcagtaggcatgacaaaatggactca			36	1559	It's complicated
BBa_K823000	PliaG	. . . caagcttttcctttataatagaatgaatga			121	7765	In stock
BBa_K823002	PlepA	. . . tctaagctagtgtattttgcgtttaatagt			157	7245	In stock
BBa_K823003	Pveg	. . . aatgggctcgtgttgtacaataaatgtagt			237	14126	In stock

Constitutive B. subtilis σ^B promoters

This section lists promoters that are recognized by B. subtilis σ^B RNAP. σ^B is the major stationary phase E. coli sigma factor. Use these promoters when you want high promoter activity during stationary phase or during starvation.

More...

Name	Description	Promoter Sequence	Positive Regulators	Negative Regulators	Length	Doc	Status
BBa_K143010	Promoter ctc for B. subtilis	. . . atccttatcgttatgggtattgtttgtaat			56	4297	Not in stock
BBa_K143011	Promoter gsiB for B. subtilis	. . . taaaagaattgtgagcgggaatacaacaac			38	2765	Not in stock
BBa_K143013	Promoter 43 a constitutive promoter for B. subtilis	. . . aaaaaaagcgcgcgattatgtaaaatataa			56	11873	Not in stock