Part:BBa_K2924014

guideRNA from mVenus

mVenus guide RNA

Usage and Biology

Fig. 1: Position of sgRNA (orange) in the mVenus gene.

This part contains guide RNA of mVenus, a fluorescent protein, which originates from Aequorea victoria and is an improved variant of YFP, which folds faster and more efficiently ¹. It was used for an induced knock-down with a CRISPRi/dCas9-system, which was kindly provided by Yao et al. (2015)². The guide RNA was obtained by using the CRISPR guide from benchling³. The sgRNA in the gene is located at 52-71 bp in the + strand (Fig. 1). The sequence of the sgRNA is GAATTGGATGGTGATGTGAA has anOn-Target Score of 70.2 and an Off-Target Score of 100.0.

The mVenus sgRNA was cloned into a vector containing a neutral site of Synechocystis sp. PCC 6803. That’s a homologous sequence of its genome to ensure a knock-in into the genome (Fig.. 2)².

Due to this knock-in containing a resistance for antibiotic and the sgRNA, we can down-regulate the target enzyme with a CRISPRi/dCas9 - system². This system is induced by anhydrotetracycline (aTc), which activates the synthesis of the dCas9, which is then binding to the sgRNA. These complex is able to bind complementary to the targeted enzyme and stops the transcription of it (Fig. 3).

Fig. 2: Scheme of a knock-in as a consequence of homologous recombination in Synechocystis.

Fig. 3: Scheme of function of the CRISPRi/dCas9 - system. The dCas9 (yellow) binds with the sgRNA to the complementary DNA strand and inhibits the transcription by RNA polymerase II (blue).

Sequence and Features

Assembly Compatibility:

• 10
  COMPATIBLE WITH RFC[10]
• 12
  COMPATIBLE WITH RFC[12]
• 21
  COMPATIBLE WITH RFC[21]
• 23
  COMPATIBLE WITH RFC[23]
• 25
  COMPATIBLE WITH RFC[25]
• 1000
  COMPATIBLE WITH RFC[1000]

Characterization

The sgRNA was designed using the “CRISPR Guides” tool on benchling ³ by choosing suitable candidate sgRNAs, which binds at the start of mVenus and cloned it via homologous recombination into the genome of Synechocystis sp. PCC 6803. Furthermore, this Synechocystis sp. PCC 6803 was transformed with a plasmid containing theP_cpc560 BBa_K2924000 and the mVenus CDS BBa_K2924035.

Effect of inducible CRISPRi/dCas9 over time

Fig. 4: Effect of the CRISPRi/dCas9-system over time. The fluorescence was measured over time starting with the induction at an OD₇₅₀ of 0.4. The cultures were measured every 6 h at λ_ex/em = 511 nm/ 552 nm and with every measurement the OD₇₅₀ was matched to 0.4 in each sample.

For testing the effect of CRISPRi/dCas9 and its active time, Synechocystis sp. PCC 6803 with sgRNA_mVenus and pSHDY_P_cpc560_mVenus colonies were inoculated in BG11 medium with 20 µg/ml spectinomycin, 25 µg/ml kanamycin and 10 µg/ml chloramphenicol at 30°C and shaked with specific light and CO₂ conditions. After a few days, the cultures were diluted to an OD₇₅₀ of 0.4. The fluorescence has been tested for two days by matching the OD₇₅₀ of the cultures to 0.4, for more consisting results, and the fluorescence was measured at λ_ex/em = 511 nm/ 552 nm (Fig. 4).

Fig. 5: Fluorescence measurement of the mVenus knock-down (KD) strain in the plate reader 24 h after induction with 500 nM aTc (red) or 100% EtOH (negative control, blue). 2 biological and 3 technical replicates were cultured in 6-well plates.

The optimal activity, and therefore the lowest measured fluorescence, of the dCas9 was measured after 24 h after the induction with 500 nM aTc (Fig. 4). To keep the expression of the gene low further induction with aTc might be necessary.

Synechocystis sp. WT and Synechocystis sp. PCC 6803 with sgRNA_mVenus and pSHDY_P_cpc560_mVenus colonies were inoculated in BG11 medium with 20 µg/ml spectinomycin, 25 µg/ml kanamycin and 10 µg/ml chloramphenicol at 30°C and shaked with specific light and CO₂ conditions using 6 well plates. After 2 days of incubation, some cultures were induced with 500 nM aTc or with 100% EtOH as a control with the same amounts added. After 24 hours, the fluorescences were measured using a plate reader. Each sample was measured in biological duplicates, which are then tested in technically triplicates (Fig. 5).

As in Fig. 5 can be seen, the overall fluorescence decreased after induction with the inducer aTc. But in comparison to the empty vector control (EVC), fluorescence can be clearly measured. This proves our concept of down-regulating a protein or enzyme without abolishing the functions completely.

Confocal Imaging

Synechocystis sp. PCC 6803 with sgRNA_mVenus and pSHDY_P_cpc560_mVenus and Synechocystis sp. PCC 6803 with pSHDY_P_cpc560_mVenus cultures were diluted to an OD₇₅₀ of 0.2 and induced with an appropriate amount of 500 nM aTc. As indicated in Fig. 4, the highest dCas activity is detected after ca. 24h, because of this 1 ml culture were taken after exact 24 hours. These samples were diluted to 1:10 and observed with a confocal microscope (Fig. 6).

Fig. 6: Overview (A and B) and detail image (C and D) of control strain (A and C) and the transformants (B and D), which were induced with 500 nM aTc and imaged after 24 h of exposure. These images were taken with a confocal microscope. It shows clearly the localization of the Synechocystis autofluorescence (purple) of the chromophores and the localization of the mVenus fluorescent protein (green).

As shown in Fig. 5, when the culture ist induced with 500 nM aTc, there is a overall lower fluorescence as in the control culture. Against the expectation, that this may be due to a gradual knockdown, it is more like a “Knock on or off”-system, as seen in Fig. 6. Most of the induced cells are showing no evidence of mVenus fluorescence (Fig. 6, D), a few of them show fluorescence which does not differ in fluorescence compared to the fluorescence of the control strain (Fig. 6, C).

References

[1]: Kremers, G. J., Goedhart, J., van Munster, E. B., & Gadella, T. W. (2006). Cyan and yellow super fluorescent proteins with improved brightness, protein folding, and FRET Förster radius. Biochemistry, 45(21), 6570-6580.

[2]:Yao, L., Cengic, I., Anfelt, J., & Hudson, E. P. (2015). Multiple gene repression in cyanobacteria using CRISPRi. ACS synthetic biology, 5(3), 207-212.

[3]: Benchling [Biology Software]. (2019). Retrieved from https://benchling.com.