RNA

Part:BBa_K2924006

Designed by: Vanessa Valencia   Group: iGEM19_Duesseldorf   (2019-10-14)
Revision as of 17:17, 21 October 2019 by Va val103 (Talk | contribs) (→‎Proof of concept)


guideRNA from acetyl coenzyme A acetyltransferase

acetyl coenzyme A acetyltransferase (thiolase) phaA guide RNA of Synechocystis sp.

Usage and Biology

This part contains the acetyl coenzyme A acetyltransferase guide RNA of Synechocystis sp. PCC 6803. It was used for an induced knock-down of phaA with a CRISPRi/dCas9-system, which was kindly provided by Yao et al. (2015)1. The acetyl coenzyme A acetyltransferase can be found under the UniProt ID: THIL_SYNY32 and is involved in fatty acid degradation and fatty acid metabolism3. The gene is positioned in the genome at 1435842 - 1437071 (1230 bp) bases 3. he guide RNA was obtained by using the CRISPR guide from benchling4. The sgRNA in the gene is located at 255 - 274 bp in the + strand (Fig. 1). The sequence of the sgRNA is ggcggagattcccgatacgg, has an On-Target Score of 66.3 and an Off-Target Score of 49.9.

Fig. 1: Position of sgRNA (orange) in the acetyl coenzyme A acetyltransferase gene.
Fig. 2: <i> Reaction scheme of the formation of acetoacetyl CoA by thiolase

Thiolase is an enzyme in the mevalonate pathway, which converts two units of acetyl-CoA to acetoacetyl CoA. It catalyzes the carbon–carbon-bond formation, which is an essential step in the biosynthetic pathways of e.g. fatty acids through thioester-dependent Claisen condensation reaction mechanism (Fig. 2)5.

The short guide RNA was cloned into a vector containing a neutral site of Synechocystis sp. PCC 6803. That’s a homologous sequence of its genome to ensure a knock-in into the genome (Fig. 3)1.

Due to the created knock-in containing a resistance for antibiotic in close proximity to the sgRNA, the target enzyme can e down-regulated with a CRISPRi/dCas9 - system 1. This system is induced by anhydrotetracycline (aTc) that activates the synthesis of the dCas9, which then binds to the sgRNA. The formed complex is able to bind complementary to the targeted gene and stops the transcription of it (Fig. 4).

Fig. 3: Scheme of a knock-in as a consequence of homologous recombination in Synechocystis.
Fig. 4: Scheme of function of the CRISPRi/dCas9 - system. The dCas9 (yellow) binds with the sgRNA to the complementary DNA strand and inhibits the transcription by RNA polymerase II (blue).



















Sequence and Features


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    COMPATIBLE WITH RFC[21]
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    COMPATIBLE WITH RFC[25]
  • 1000
    COMPATIBLE WITH RFC[1000]



Characterization

For testing the created system the cultures were induced with aTc and the growth rates were documented for few days. To check the transcriptional activity on the targeted gene, a qPCR was performed from pelletized cultures. Finally, the varying percentage yields of fatty acids were measured via gas chromatography-mass spectrometry.

Proof of concept

Fig. 5: Fluorescence measurement of the mVenus knock-down (KD) strain in the plate reader 24 h after induction with 500 nM aTc (red) or 100% EtOH (negative control, blue). 2 biological and 3 technical replicates were cultured in 6-well plates.

This concept has been tested with the fluorescent protein mVenus. The sgRNA was designed using the “CRISPR Guides” tool on benchling4 by choosing suitable candidate sgRNAs, which binds at the start of mVenus and cloned it via homologous recombination into the genome of Synechocystis sp. PCC 6803. Furthermore, this Synechocystis sp. PCC 6803 was transformed with a plasmid containing the Pcpc560 BBa_K2924000 and the mVenus CDS BBa_K2924035.

Synechocystis sp. WT and Synechocystis sp. PCC 6803 with sgRNA_mVenus and pSHDY_Pcpc560_mVenus colonies were inoculated in BG11 medium with 20 µg/ml spectinomycin, 25 µg/ml kanamycin and 10 µg/ml chloramphenicol at 30°C and shaked with specific light and CO2 conditions using 6 well plates. After 2 days of incubation, some cultures were induced with 500 nM aTc or with 100% EtOH as a control with the same amounts added. After 24 hours, the fluorescences were measured using a plate reader. Each sample was measured in biological duplicates, which are then tested in technically triplicates (Fig. 5).

As in Fig. 5 can be seen, the overall fluorescence decreased after induction with the inducer aTc. But in comparison to the empty vector control (EVC), fluorescence can be clearly measured. This proves our concept of down-regulating a protein or enzyme without abolishing the functions completely.

Thiolase knock-down experiments

After inoculation and incubation of Synechocystis sp. PCC 6803 transformants with sgRNA_thiolase (BBa_K2924006) in BG11, they were diluted to an OD750= 0.2 and induced with an appropriate amount of 0,1 µg/ml aTc while the following antibiotics were added: 20 µg/ml spectinomycin and 25 µg/ml kanamycin. The cultures were incubated at 30°C and shaken under specific light and CO2 conditions.

Fig. 6: Growth curve of <i>Synechocystis sp. PCC 6803 transformants after induction with 500 nM aTc over about 120 h.</i>
Fig. 7: The relative expression of different clones containing the same sgRNA for acetyl coenzyme A acetyltransferase (thiolase). The control resembles strains expressing the long-chain-fatty-acid CoA ligase without induction of the sgRNA. The clones resemble strains expressing the acetyl coenzyme A acetyltransferase (thiolase) with induction of the sgRNA targeting the gene.

The growth rate of Synechocystis sp. PCC 6803 transformants was not affected by the knockdown of acetyl coenzyme A acetyltransferase (Fig. 6).

The transcription of genes can be detected by a qPCR. Therefore, it can be used to validate the level of the transcription of a gene of interest due to specific primer. In this case, the knockdown target acetyl coenzyme A acetyltransferase (thiolase) and the housekeeping gene for technical faults (rnpB) were analysed. The cultures were induced with aTc [500nM] and after 24 h 1.5 ml of the cultures were pelletized to perform a qPCR (Fig. 7).








The expression level for some of the transformants is lower than in the control (Fig. 7). This is caused by the CRISPRi/dCas9-Knockdown system. Clones 1 and 2 seem to be the most promising ones.












GC-MS

For the fatty acid composition analysis in Synechocystis sp., the transformants and a control were grown under the same grow conditions. 4 optical density units of cells, usually, an equivalent of 4 ml cells at OD600 = 1, were isolated and used for extraction and derivatization of fatty acids. The extract was used for gas chromatography-mass spectrometry (GC-MS) (Fig. 8).

Fig. 8: Effect of CRISPRi/dCas9-system with the sgRNA of acetyl coenzyme A acetyltransferase on the fatty acid profile and yield of different fatty acids. The control resembles a Synechocystis strain without down regulation. The clones resemble Synechocystis strains with downregulated acetyl coenzyme A acetyltransferase.

As shown in Figure 8, the overall fatty acid yield between C16:0 and C18:3 of the transformant is slightly lower than the control. This may be due to the knockdown of the acetyl coenzyme A acetyltransferase (thiolase).

References

[1]: YAO, Lun, et al. Multiple gene repression in cyanobacteria using CRISPRi. ACS synthetic biology, 2015, 5. Jg., Nr. 3, S. 207-212.

[2]: https://www.uniprot.org/uniprot/P73825

[3]: https://www.genome.jp/dbget-bin/www_bget?syz:MYO_113180

[4]: Benchling [Biology Software]. (2019). Retrieved from https://benchling.com.

[5] : Haapalainen AM et al., January 2006. "The thiolase superfamily: condensing enzymes with diverse reaction specificities". Trends Biochem. Sci. 31 (1): 64–71. doi:10.1016/j.tibs.2005.11.011. PMID 16356722

[edit]
Categories
Parameters
None