Collections/Probiotics
This collection is a user contributed collection, and is not under curation by iGEM HQ/Registry.
Control
nissle
| Name | Description | Type | Created by | length | uses | seq |
|---|---|---|---|---|---|---|
| BBa_R0082 | Promoter (OmpR, positive) | Regulatory | Stephen Lee, Roshan Kumar, Joe Levine, Ziyan Chu (Polkadorks, IAP 2004) | 108 | 126 | . . . attattctgcatttttggggagaatggact |
| BBa_K118011 | PcstA (glucose-repressible promoter) | Regulatory | Andrew Hall | 131 | 17 | . . . tagaaacaaaatgtaacatctctatggaca |
| BBa_K216005 | PyeaR promoter, responsive to nitrate, nitrite and nitric oxide | Regulatory | Edinburgh iGEM 2009 | 100 | 30 | . . . aatgcaaattatcaggcgtaccctgaaacg |
| BBa_K318512 | gadA (pH promoter and RBS) | Regulatory | Sarah R. Sandock | 264 | 2 | . . . tattgccttcaaataaatttaaggagttcg |
| BBa_K554001 | flhDC promoter | Regulatory | UNICAMP EMSE Brazil team | 85 | 5 | . . . taaagttggttattctgggtgggaataatg |
| BBa_K239005 | NarK promoter, Fnr activated under anaerobic conditions | Regulatory | Axel Nystrom | 139 | 4 | . . . cctttagctacagacactaaggtggcagac |
| BBa_K223044 | SoxR - SoxS Promoter System | Regulatory | Suzanne Bartram | 776 | . . . aacgaactgtactagtagcggccgctgcag | |
| BBa_K234095 | Gal 1/10 divergent promoter | Regulatory | Daniel Jedrysiak | 686 | 2 | . . . caaggagaaaaaaccccggatcctattaaa |
| BBa_K875001 | T5 Cumate Operator | Regulatory | Federico Colombo, Elisa Clagnan | 85 | 4 | . . . caaacagacaatctggtctgtttgtattat |
| BBa_K1202116 | pLsr Complete System (Receiver) | Composite | safa tapan | 3450 | . . . agcctgtggaaagcaccgggtctgtaataa | |
| BBa_K1980004 | pCusC promoter | Regulatory | Sam Garforth | 98 | 1 | . . . agagcctggcgagtaaagttggcggcataa |
| BBa_K1980005 | pCopA sfGFP | Reporter | Sam Garforth | 810 | . . . tacaaacatcatcaccaccatcactaataa | |
| BBa_K1980008 | pCopA CueR sfGFP/ feedback pCopA sfGFP | Reporter | Sam Garforth | 1252 | . . . tacaaacatcatcaccaccatcactaataa | |
| BBa_K2447011 | Temperature sensitive promoter pTlpA | Regulatory | Chee Wai Kit (david) | 52 | 12 | . . . ttatttgttggtttgtttgtgttataatat |
| BBa_K2447013 | Temperature-sensitive repressible system | Regulatory | Chee Wai Kit (david) | 1409 | 3 | . . . ttatttgttggtttgtttgtgttataatat |
| BBa_K3733002 | EBS-PyeaR: The promoter responsive to nitrate with extra NarL binding site | Regulatory | Zhenhao Han | 116 | -1 | . . . aatgcaaattatcaggcgtaccctgaaacg |
| BBa_K3733004 | PphsA151-342 | Regulatory | Zhenhao Han | 192 | -1 | . . . ctaaggacaactgtcattgggagatttaac |
| BBa_K223041 | SoxS Promoter | Regulatory | Suzanne Bartram | 105 | 4 | . . . aacgaactgtactagtagcggccgctgcag |
| BBa_K2118000 | atoC Promoter | Regulatory | Laura Ros-Freixedes | 115 | 1 | . . . tttattatttttaaaagaggaaattaaacg |
| BBa_K2447014 | IPTG-inducible temperature-sensitive system with GFP reporter | Measurement | Chee Wai Kit (david) | 3516 | . . . caccttcgggtgggcctttctgcgtttata | |
| BBa_K2447015 | Phosphate-dependent, temperature-sensitive cascaded system with GFP reporter | Measurement | Chee Wai Kit (david) | 2792 | . . . caccttcgggtgggcctttctgcgtttata |
lactobacillus
| Name | Description | Type | Created by | length | uses | seq |
|---|---|---|---|---|---|---|
| BBa_K1725000 | PhlF repressible promoter | Regulatory | Mhairi Davidson | 48 | 7 | . . . atgatacgaaacgtaccgtatcgttaaggt |
| BBa_K128006 | L.bulgaricus LacS Promoter | Regulatory | Derek Ju | 197 | . . . aacaagttaacacacctaaaggagaatttc | |
| BBa_K559011 | Pgad - Intracellular Chloride-Sensing Cassette | Regulatory | Jacky, Fong Chuen, Loo | 1251 | 8 | . . . attcaatcataaatataaggaggtatgatg |
| BBa_K1130003 | L. plantarum RBS | RBS | Alicia Gabriela Quiroz Rocha | 33 | . . . atcgcaagacaaattagaaggaggtataga | |
| BBa_K2230012 | Pcar-wRBS-PhlF-T-Pr-sRBS-GFP/pSB1C3 | Device | Yi-Lun Huang | 1577 | 2 | . . . catggcatggatgaactatacaaataataa |
| BBa_K2253000 | Constitutive P8 promoter and RBS composite | Composite | Andrew Ly | 169 | . . . ttgatatagcagcagaaatggagagatata | |
| BBa_K2253001 | Constitutive P32 promoter and RBS composite | Composite | Andrew Ly | 153 | . . . aggtaaaaaaatattcggaggaattttgaa | |
| BBa_K861170 | PI ,Glucose-activated promoter | Regulatory | Kuanwei Sheng | 36 | 8 | . . . gctagctcaaatgtgattataatcacattt |
lactococcus
| Name | Description | Type | Created by | length | uses | seq |
|---|---|---|---|---|---|---|
| BBa_K1033219 | Promoter CP1 | Regulatory | Stephanie Herman, Alona Nyberg | 60 | . . . ctcgggttgatataatatctcagtactgtt | |
| BBa_K1033220 | Promoter CP8 | Regulatory | Stephanie Herman, Alona Nyberg | 60 | . . . tgaggactgatataataggtgagtactgtt | |
| BBa_K1033221 | Promoter CP11 | Regulatory | Stephanie Herman, Alona Nyberg | 59 | 3 | . . . cccccctttgatataataagtagtactgtt |
| BBa_K1033222 | Promoter CP29 | Regulatory | Stephanie Herman, Alona Nyberg | 59 | 4 | . . . ggggacgtggtataataactgagtactgtt |
| BBa_K1033223 | Promoter CP30 | Regulatory | Stephanie Herman, Alona Nyberg | 60 | . . . gttactttggtataatagttgagtactgtt | |
| BBa_K1033224 | Promoter CP41 | Regulatory | Stephanie Herman, Alona Nyberg | 60 | . . . gtagacgtggtataatagttaagtactgtt | |
| BBa_K1033225 | Promoter CP44 | Regulatory | Stephanie Herman, Alona Nyberg | 59 | 3 | . . . tagagcctgatataatagttcagtactgtt |
| BBa_K2270005 | gal promoter from Lactococcus lactis | Regulatory | Nathan Vinicius Ribeiro, Danielle Biscaro Pedrolli | 218 | 2 | . . . agtgttatactctaaatgtgagcgatttca |
| BBa_K2270006 | regulatory small RNA for L. lactis | RNA | Nathan Vinicius Ribeiro, Danielle Biscaro Pedrolli | 109 | 1 | . . . aaatgaagaagaaactgtgaagcgtattta |
| BBa_K2270008 | galP-sRNA-rrnb(Bs) | Composite | Nathan Vinicius Ribeiro | 327 | 1 | . . . aaatgaagaagaaactgtgaagcgtattta |
| BBa_K2253000 | Constitutive P8 promoter and RBS composite | Composite | Andrew Ly | 169 | . . . ttgatatagcagcagaaatggagagatata | |
| BBa_K2253001 | Constitutive P32 promoter and RBS composite | Composite | Andrew Ly | 153 | . . . aggtaaaaaaatattcggaggaattttgaa | |
| BBa_K2660002 | gal promoter driving the expression of TetR | Regulatory | Nathan Vinicius Ribeiro | 1066 | 1 | . . . caccttcgggtgggcctttctgcgtttata |
subtilis
| Name | Description | Type | Created by | length | uses | seq |
|---|---|---|---|---|---|---|
| BBa_K2660002 | gal promoter driving the expression of TetR | Regulatory | Nathan Vinicius Ribeiro | 1066 | 1 | . . . caccttcgggtgggcctttctgcgtttata |
| BBa_K2660005 | T7 RNA Polymerase regulated by TetR | Generator | Danielle Biscaro Pedrolli, Nathan Vinicius Ribeiro | 2872 | 1 | . . . caccttcgggtgggcctttctgcgtttata |
| BBa_K2660010 | glucose-responsive regulatory circuit | Generator | Danielle Biscaro Pedrolli, Nathan Vinicius Ribeiro | 5044 | . . . actggtggtatggatgaactttacaaataa |