Part:BBa_K2332312
E-cadherin (Preproprotein, Mus Musculus)
| E-cadherin (Preproprotein, Mus Musculus) | |
|---|---|
| Function | Cell-Cell Adhesion |
| Use in | Mammalian cells |
| Chassis Tested | Chinese Hamster Ovary (CHO) |
| Abstraction Hierarchy | Part |
| Related Device | BBa_K2332313 |
| RFC standard | RFC10 & RFC23 compatible |
| Backbone | pSB1C3 |
| Submitted by | [http://2017.igem.org/Team:UCL UCL iGEM 2017] |
This gene encodes E-cadherin, a calcium-dependent cell adhesion molecule that functions in the establishment and maintenance of epithelial cell morphology during embryongenesis and adulthood. The encoded preproprotein undergoes proteolytic processing to generate a mature protein.
Contents
As part of 2017 UCL iGEM project LIT we sought to demonstrate that BioBrick-based expression of Ecadherin could drive calcium-dependent cell-cell aggregation in mammalian cells. In the experiments set out below we demonstrated that, relative to control experiments, the proportion of aggregated CHO cells was increased by cells transfected with our Ecadherin expression plasmid (using SuperFect as the transfection reagent) in the presence of calcium (Table 2). Also, for cells in the presence of Superfect, E-cadherin expression plasmid and calcium significantly increased the abosolute number of aggregated cells (Diagram 1).
Usage and Biology
Cell-cell junctions come in many forms and can be regulated by a variety of different mechanisms. The best understood and most common are the two types of cell-cell anchoring junctions which employ cadherins to link the cytoskeleton of one cell with that of its neighbour. Their primary function is to resist the external forces that pull cells apart. At the same time, however, they need to dynamic and adaptable, so that they can be altered or rearranged when tissues are remodelled or repaired or when there are changes in the forces acting on them.
.png)
(A) Adherens junctions, in the form of adhesion belts, between epithelial cells in the small intestine. The beltlike junction encircles each of the interacting cells. Its most obvious feature is a contractile bundle of actin filaments running along the cytoplasmic surface of the junctional plasma membrane. (B) Some of the molecules that form an adherens junction. The actin filaments are joined from cell to cell by transmembrane adhesion proteins called cadherins. (Alberts B. Molecular Biology of the Cell. 6th ed. New York: Garland Science; 2015)
Cadherins are a diverse family of adhesion molecules that fulfil these requirements. They are present in all multicellular animals whose genomes have been analysed. Other eukaryotes, including fungi and plants, lack cadherins, and they are also absent from bacteria and archaea. Cadherins therefore seem to be part of the essence of what it is to be an animal.
The cadherins take their name from their dependence on Ca2+ ions: removing Ca2+ from the extracellular medium causes adhesions mediated by cadherins to come apart. The first three cadherins to be discovered were named according to the main tissues in which they were found:
- E-cadherin is present on many types of epithelial cells;
- N-cadherin on nerve, muscle and lens cells;
- P-cadherin on cells in the placenta and epidermis.
All are also found in other tissues. These and other classical cadherins are closely related in sequence throughout their extracellular and intracellular domains.
Binding between cadherins is generally homophilic. This means cadherin molecules of a specific subtype on one cell bind to cadherin moleculs of the same or closely related subtype on adjacent cells. All members of the superfamily have an extracellular portion consisting of several copies of the extracellular cadherin (EC) domain. Homophilic binding occurs at the N-terminal tips of the cadherin molecules - the cadherin domains that lie furthest from the membrane. These terminal domains each form a knob and a nearby pocket, and the cadheirn molecules protruding from opposite cell membranes bind by insertion of the knob of one domain into the pocket of the other.
After processing in the late Golgi, E-cadherin contains five EC domains. The outermost EC domain forms homophilic connections with the equivalent domain of E-cadherin on the neighbouring cell. The stability of E-cadherin depends on the presence of Ca2+ in the extracellular space. (Alberts B. Molecular Biology of the Cell. 6th ed. Figure 19-6 New York: Garland Science; 2015)
Each cadherin domain forms a more-or-less rigid unit, joined to the next cadherin domain by a hing. Ca2+ ions bind to sites near each hinge and prevent it from flexing, so that the whole string of cadherin domains behaves as a rigid and slightly curved rod. When Ca2+ is removed, the hinges can flex, and the structure becomes floppy. At the same time, the conformation at the N-terminus is thought to change slightly, weakening the binding affinity for the matching cadherin molecule on the opposite cell.
The cadherins form homodimers in the plasma membrane of each interacting cell. The extracellular domain of one cadherin dimer binds to the extracellular domain of an identical cadherin dimer on the adjacent cell. The intracellular tails of the cadherins bind to anchor proteins that tie them to actin filaments. These anchor proteins include α-catenin, β-catenin, γ-catenin (also called plakoglobin), α-actinin, and vinculin.
UCL iGEM 2017 believes that cadherin proteins will be powerful modulators for efficient tissue engineering. We therefore investigated first the properties of one classical cadherin (E-cadherin, BBa K2332312) and then tried to make it light-responsive.
For more information on cell-cell junctions and cadherins see Alberts B., Molecular Biology of the Cell. 6th ed., Ch.19, New York: Garland Science; 2015.
E-Cadherin Entries in the Registry
UCSF iGEM 2011 has created a BioBrick of only the extracellular domain of E-Cadherin (Mouse) BBa_K644000 but no BioBrick encoding the full E-cadherin protein has been submitted until now. BBa_K644000 also lacked detailed characterisation and the source was imprecise. Furthermore, we know now that E-cadherin requires interaction of its cytosolic domain for the production of stable cell-cell connections. (see Alberts 6th Ed. 2015, Ch. 19, p. 1040).
Experimental approach
Vector Considerations
For testing this coding part we used pcDNA3 [http://www.snapgene.com/resources/plasmid_files/basic_cloning_vectors/pcDNA3/ (SnapGene File)], a standard mammalian expression plasmid, as a vector. We, thereby, created the coding device BBa_K2332313, our E-cadherin gene flanked by a CMV promoter and a bGH poly(A) tail. The well characterised strong promoter, efficient poly(A) tail and the pre-existing 5'- and 3'-UTR ensure efficient expression of E-cadherin after transfection.
There are many ways to express mammalian genes. Using a standard mammalian expression plasmid saves time and reduces the risk of low expression due to variations in 5'- and 3'- UTR.
Chassis Considerations
Choosing the correct chassis for your experiments is of equal importance to choosing the correct gene.
Since we wanted to test cell-cell aggregation induced by the E-cadherin gene, we therefore chose a mammalian cell line that naturally does not express E-cadherin and is commonly used in cadherin research, Chinese Hamster Ovary (CHO) cells. Even though they naturally lack E-cadherin expression they still maintain alpha- and beta-catenin expression, the two proteins that are essential for E-cadherin's connection to the actin cortex of the cell.
Experimental Setup
The experiment was carried out in a 6-well plate, in which wells were marked from A to E.
The well contents were the following:
- Well A: cells + superfect + plasmid
- Well B: cells + superfect + plasmid + calcium
- Well C: control cells
- Well D: control cells + calcium
- Well E: untreated cells
Control cells = treated with superfect + PBS instead of plasmid
CaCl2 solution preparation:
1. Prepare 1 mM CaCl2 stock solution by dissolving 11 mg CaCl2 in 100 mL CMF-HBSS.
HBSS (Hanks’ balanced salt solution) preparation (for 200 mL stock):
- 0.08 g KCl
- 0.012 g Na2HPO4*2H20
- 0.012 g KH2PO4
- 0.07 g NaHCO3
- 0.028 g CaCl2
- 1.6 g NaCl
- 0.2 g D-glucose
Add water to 200 mL. Filter, sterilize and store up to a month at 4 degrees Celsius.
2. Dilute 25x.
Results and Discussion
After the transfection, cells were incubated at 37°C and 5% CO2. 46 h after the transfection cells from the 6-well plate were transferred into adherent cells dishes. 7 mL growth media was added to each well and gently mixed with the cells. Cells were incubated for another 60 minutes at 37 °C and 5% CO2.
Afterwards, pictures of the cells were taken under the phase-contrast microscope. For each condition, 3 pictures at the same magnification were taken and single cells and aggregated cells were counted. The ratio of single to aggregated cells was calculated based on the average counts (see the table below). All individual cells were classified as single cells, while the clumps of 3 or more cells were classified as aggregated. The number of cells in each aggregate was counted.
Aggregate definition: clump of 3 or more cells
Because E-cadherin only functions in presence of calcium ions, we would expect the cells in well B to have the highest percentage of aggregates, which is what we supported by this experiment. As shown in the graph, the percentage of aggregates is notably above 50 % only in well B.
The addition of Superfect (wells A, B, C and D) significantly reduced total number of all cells and total number of aggregated cells as compared to number of aggregated cells in untreated cells (well E). Based on that, it can be concluded that Superfect acts against aggregation as only the cells treated with plasmid, Superfect and calcium ions reached the levels of aggregated cells comparable to those of untreated cells.
Taken together, these 2 observations are consistent with calcium-dependent effect of E-cadherin to promote cell aggregation.
For analysis, we took the ratio between free and aggregate cells per field of view using the ratio as the individual observation. Ratios were averaged and, assuming that our measurements are normally distributed, normalised against the control (well C). The normalised data was analysed using a Student t-test (one-tailed, homoscedastic populations). Analysis suggests that the E-cadherin plasmid does lead to a change in aggregation (p < 0.05). Null hypothesis: Plasmid has no impact on aggregation. p value (comparison between C and A) = 0.012 Because this experiment is the result of a single transfection experiment and the replicates are technical rather than biological replicates, the observations are preliminary but would support that the cadherin plasmid lead to an increase in aggregation.
Verdict: Our E-cadherin significantly increased the number of cell aggregations in the culture (assessed in terms of percentage) and therefore fulfils the designed purpose.
Usability
A functional, natural cell-cell adhesion protein like BBa_K2332312 has potential in many different fields:
Tissue engineering is dependent on the formation of lasting connections between cells. By choosing E-cadherin to form such connections you mimic the bodies natural way of adhering cells into a 3-dimensional structure. This holds the potential to lead to functional for replacements for destroyed tissue in patients one day.
For bioprocessing, tissue structures can be polarised and arranged for maximal surface to volume ratio. They can form separate compartments for nutrient uptake on one side and biomolecule production on a different side, thereby streamlining a production process in mammalian cells for complex molecules.
Primer Designs
PCR out Primers
5'- agcttggtacctccac -3', Ecadh_BioBrick.FwP 5'- tctagtcgtcctcgcc -3', Ecadh_BioBrick.RevP
These are the primers UCL iGEM 2017 used to clone E-cadherin out of the plasmid that Prof. Price gave us. We attached the BioBrick prefix to the 5'-end of the forward primer (+10 additional base pairs for efficient cleavage) and the BioBrick suffix to the 5'-end of the reverse primer (+10 additional base pairs for efficient cleavage). Through overhang PCR with these primers we created the BioBrick BBa_K2332312.
Sequencing Primers
We used Sanger sequencing for the sequencing of our E-cadherin gene. However, since Sanger sequencing only ensures correct results for up to around 800 bp we needed to use 2 sequencing steps ('primer walking') with two primers in each step:
Since the gene was in pcDNA3 we used the standard primers for pcDNA3.1 for the first round of sequencing:
5'- ctctggctaactagagaac -3', pcDNA3.1-FwP 5'- caaacaacagatggctggc -3', pcDNA3.1-RevP
For the second round of sequencing we designed and synthesized the following primers:
5'- tcaacacctacaacgctgc -3', E-cadh.sequ.Round2-FwP 5'- aggttctgggatgggagc -3', E-cadh.sequ.Round2-RevP
Characterisation Opportunities
This E-cadherin is not RFC25 compatible because of a single NgoMIV site at position 208. UCL iGEM 2017 suggests to use side directed mutagenesis to remove said NgoMIV cutting site and to use our primers with RFC25 overhangs to create an RFC25 compatible E-cadherin registry entry.
Sequence and Features
DNA Features
- 10COMPATIBLE WITH RFC[10]
- 12INCOMPATIBLE WITH RFC[12]Illegal NheI site found at 2550
- 21INCOMPATIBLE WITH RFC[21]Illegal BamHI site found at 752
Illegal BamHI site found at 828
Illegal BamHI site found at 944
Illegal BamHI site found at 1868
Illegal BamHI site found at 2170
Illegal XhoI site found at 1552 - 23COMPATIBLE WITH RFC[23]
- 25INCOMPATIBLE WITH RFC[25]Illegal NgoMIV site found at 208
- 1000INCOMPATIBLE WITH RFC[1000]Illegal BsaI site found at 65
Illegal BsaI site found at 465
Illegal BsaI site found at 872
Illegal BsaI site found at 1414
Illegal BsaI.rc site found at 306
This gene was given to the UCL iGEM team 2017 by Prof. Stephen Price (UCL, not part of iGEM) after we searched for cadherin proteins suitable for our project. However, no sequence was known of the plasmid we were given and we sequenced the plasmid ourselves. Consecutive BLAST analysis of the results showed a 99% similarity with Mus musculus cadherin 1 (Cdh1), mRNA: NCBI Reference Sequence: NM_009864.3, NCBI.
Three silent mutations were added into the sequence via side directed mutagenesis in order to remove one EcoRI and two PstI sites. Afterwards we sequence confirmed the entire gene.
Protein Features
.png)
Cadherin Prodomain Like - Cadherin proteins are activated through cleavage of a prosequence in the late Golgi. This prevents cadherin aggregation in the early stage of the secretory pathway. This domain corresponds to the folded region of the prosequence, and is termed the prodomain. The prodomain shows structural resemblance to the cadherin domain, but lacks all the features known to be important for cadherin-cadherin interactions.
Cadherin Repeat-Like Domain- The cadherin repeat domains occur as tandem repeats in the extracellular regions, which are thought to mediate cell-cell contact when bound to calcium. They play numerous roles in cell fate, signalling, proliferation, differentiation, and migration; members include E-, N-, P-, T-, VE-, CNR-, proto-, and FAT-family cadherin, desmocollin, and desmoglein, a large variety of domain architectures with varying repeat copy numbers. Cadherin-repeat containing proteins exist as monomers, homodimers, or heterodimers. This family also includes the cadherin-like repeats of extracellular alpha-dystroglycan.Cadherin Cytoplasmic Region- Cadherins are vital in cell-cell adhesion during tissue differentiation. Cadherins are linked to the cytoskeleton by catenins. Catenins bind to the cytoplasmic tail of the cadherin. Cadherins cluster to form foci of homophilic binding units. A key determinant to the strength of the binding that it is mediated by cadherins is the juxtamembrane region of the cadherin. This region induces clustering and also binds to the protein p120ctn.
Functional Parameters
| Protein data table for BioBrick BBa_ automatically created by the BioBrick-AutoAnnotator version 1.0 | ||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Nucleotide sequence in RFC 10: (underlined part encodes the protein) AGCTTGGTACCTCCACCATGGGAGCC ... GAGGACGACTAGA ORF from nucleotide position 18 to 2669 (excluding stop-codon) | ||||||||||||||||||||||||||||||||||||||||||||||
Amino acid sequence: (RFC 25 scars in shown in bold, other sequence features underlined; both given below)
| ||||||||||||||||||||||||||||||||||||||||||||||
Sequence features: (with their position in the amino acid sequence, see the list of supported features)
| ||||||||||||||||||||||||||||||||||||||||||||||
Amino acid composition:
| ||||||||||||||||||||||||||||||||||||||||||||||
Amino acid counting
| Biochemical parameters
| |||||||||||||||||||||||||||||||||||||||||||||
| Plot for hydrophobicity, charge, predicted secondary structure, solvent accessability, transmembrane helices and disulfid bridges | ||||||||||||||||||||||||||||||||||||||||||||||
Codon usage
| ||||||||||||||||||||||||||||||||||||||||||||||
| Alignments (obtained from PredictProtein.org) There were no alignments for this protein in the data base. The BLAST search was initialized and should be ready in a few hours. | ||||||||||||||||||||||||||||||||||||||||||||||
| Predictions (obtained from PredictProtein.org) | ||||||||||||||||||||||||||||||||||||||||||||||
| There were no predictions for this protein in the data base. The prediction was initialized and should be ready in a few hours. | ||||||||||||||||||||||||||||||||||||||||||||||
| The BioBrick-AutoAnnotator was created by TU-Munich 2013 iGEM team. For more information please see the documentation. If you have any questions, comments or suggestions, please leave us a comment. | ||||||||||||||||||||||||||||||||||||||||||||||
References
1. Huber, Weis (2001) The Structure of the b-Catenin/E-Cadherin Complex and the Molecular Basis of Diverse Ligand Recognition by b-Catenin. Cell. Vol. 105, 391–402, May 4, 2001 (NCBI)
2. Alberts B. Molecular Biology of the Cell; 6th ed.; Ch. 19. New York: Garland Science; 20153. Clarke, Miller,Lowe, Weis, Nelson (2016) Characterization of the Cadherin–Catenin Complex of the Sea Anemone Nematostella vectensis and Implications for the Evolution of Metazoan Cell–Cell Adhesion. Mol. Biol. Evol. 33(8):2016–2029 (NCBI)
4. Shapiro, Weis (2009) Structure and Biochemistry of Cadherins and Catenins. Cold Spring Harb Perspect Biol. Sep;1(3):a003053 (NCBI)
| None |