Regulatory

Part:BBa_K2259015

Designed by: Laurynas Karpus   Group: iGEM17_Vilnius-Lithuania   (2017-10-01)
Revision as of 13:39, 31 October 2017 by Ignasmazelis (Talk | contribs)


Toehold 2 of SynORI selection system

Second of the two riboregulatory sequences implemented into SynORI selection system, designed by Green, Alexander A. et al. The sequence acts as an on/off switch to regulate the translation of the downstream gene. It is activated by a trigger RNA part:BBa_K2259017. In the absence of RNA trigger transcript, toehold locks the translation of a downstream gene. By introducing trigger RNA transcript, the translation is free to initiate and produce the gene of interest.

The Toehold linker sequence has an additional T nucleotide at the 3’ end to stay in frame with the downstream gene as it starts the translation which propagates into downstream biobrick.

It is important to note, that it is advised to use this part with downstream coding sequences that has a prefix sequence 5' GAATTCGCGGCCGCTTCTAGAG '3 (used with non-coding sequences), as the standard prefix (and its scar) for protein coding genes contains a stop codon.



Sequence and Features


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    COMPATIBLE WITH RFC[21]
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    COMPATIBLE WITH RFC[25]
  • 1000
    COMPATIBLE WITH RFC[1000]



Introduction

Biology

The overview of Toehold riboregulators

Figure 1. Main principle mechanism of Toehold Switch by Green, Alexander A. et al

Toehold is a short RNA sequence that contains a ribosome binding site and a start codon followed by 9 amino acid linker. Importantly, it forms a stable secondary RNA hairpin structure that, in addition to locking the start codon in the stem loop, sequesters the ribosome binding site in a bulge loop. As a consequence of stable secondary structure, the ribosome cannot bind and initiate the translation of a downstream gene. The linker codes for low-molecular-weight amino acids added to the N terminus of the gene of interest. This sequence increases the orthogonality of the toehold switches as it is important in forming the base of the stem loop and locks the start codon in it. The trigger RNA binds the 5’ end of the toehold and initiates strand displacement by linear-linear interaction. As a result of that, the ribosome binding site and the start codon are accessible for ribosome binding and translation initiation. Since the trigger RNA binds the 5’ end of the toehold sequence, the nucleotide composition of it is an important factor that adds to the degree of different toehold systems cross interaction. By employing a specific linker sequence, the number of unique triggers with minimal cross interaction increases.


Usage with SynORI (Framework for multi-plasmid systems)

About SynORI

Aboutsynoritry1.png

SynORI is a framework for multi-plasmid systems created by Vilnius-Lithuania 2017 which enables quick and easy workflow with multiple plasmids, while also allowing to freely pick and modulate copy number for every unique plasmid group! Read more about [http://2017.igem.org/Team:Vilnius-Lithuania SynORI here]!

Toehold riboregulators in SynORI

Toehold switches together with their corresponding RNA triggers and split antibiotic genes completes the dynamic SynORI selection system. The switches lock the translation of downstream split antibiotic genes and form an AND type gate genetic circuit which functions to stably maintain multiple plasmids in the SynORI collection. Toehold switches are used for these multi plasmid systems:

  1. • 2 plasmids

Uses: two split antibiotic genes (part:BBa_K2259018 and part:BBa_K2259019)

  1. • 3 plasmids

Uses: One toehold (part:BBa_K2259014 or part:BBa_K2259015), One trigger RNA (part:BBa_K2259016 or part:BBa_K2259017) and split antibiotic genes (part:BBa_K2259018 and part:BBa_K2259019).

  1. • 4 plasmids

Uses: two toeholds (part:BBa_K2259014 and part:BBa_K2259015), Two trigger RNAs (part:BBa_K2259016 and part:BBa_K2259017) and split antibiotic genes (part:BBa_K2259018 and part:BBa_K2259019).

  1. • 5 plasmids

Uses: Modified phage control system part:BBa_K2259044, Two toeholds (part:BBa_K2259014 and part:BBa_K2259015), Two repressed trigger RNAs (part:BBa_K2259042 and part:BBa_K2259043) and split antibiotic genes (part:BBa_K2259018 and part:BBa_K2259019).

Two groups of Toeholds

SynORI collection introduces two Toehold sequences termed Toehold 1 and Toehold 2 which only interact with its corresponding Trigger RNA, termed Trigger 1 and Trigger 2 and display no cross interaction.



References

Toehold Switches: De-Novo-Designed Regulators of Gene Expression

Green, Alexander A. et al. Cell , Volume 159 , Issue 4 , 925 - 939

[edit]
Categories
//awards/part_collection/2017
//collections/synori
Parameters
None