Part:BBa_K2259014
Toehold 1 of SynORI selection system
First of the two riboregulatory sequences implemented into SynORI selection system, designed by Green, Alexander A. et al. The sequence acts as an on/off switch to regulate the translation of the downstream gene. It is activated by a trigger RNA part:BBa_K2259016. In the absence of RNA trigger transcript, toehold locks the translation of a downstream gene. By introducing trigger RNA transcript, the translation is free to initiate and produce the gene of interest.
The Toehold linker sequence has an additional T nucleotide at the 3’ end to stay in frame with the downstream gene as it starts the translation which propagates into downstream biobrick.
It is important to note, that it is advised to use this part with downstream coding sequences that have a prefix sequence 5' GAATTCGCGGCCGCTTCTAGAG '3 (used with non-coding sequences), as the standard prefix (and its scar) for protein coding genes contain a stop codon.
Sequence and Features
- 10COMPATIBLE WITH RFC[10]
- 12COMPATIBLE WITH RFC[12]
- 21COMPATIBLE WITH RFC[21]
- 23COMPATIBLE WITH RFC[23]
- 25COMPATIBLE WITH RFC[25]
- 1000COMPATIBLE WITH RFC[1000]
Contents
Introduction
Biology
The overview of Toehold riboregulators
A toehold is a short RNA sequence that contains a ribosome binding site and a start codon followed by 9 amino acid linker. Importantly, it forms a stable secondary RNA hairpin structure that, in addition to locking the start codon in the stem loop, sequesters the ribosome binding site in a bulge loop. As a consequence of stable secondary structure, the ribosome cannot bind and initiate the translation of a downstream gene. The linker codes for low-molecular-weight amino acids added to the N terminus of the gene of interest. This sequence increases the orthogonality of the toehold switches as it is important in forming the base of the stem loop and locks the start codon in it. The trigger RNA binds the 5’ end of the toehold and initiates strand displacement by linear-linear interaction. As a result of that, the ribosome binding site and the start codon are accessible for ribosome binding and translation initiation. Since the trigger RNA binds the 5’ end of the toehold sequence, the nucleotide composition of it is an important factor that adds to the degree of different toehold systems cross interaction. By employing a specific linker sequence, the number of unique triggers with minimal cross interaction increases.
Usage with SynORI (Framework for multi-plasmid systems)
About SynORI
SynORI is a framework for multi-plasmid systems created by Vilnius-Lithuania 2017 which enables quick and easy workflow with multiple plasmids, while also allowing to freely pick and modulate copy number for every unique plasmid group! Read more about [http://2017.igem.org/Team:Vilnius-Lithuania SynORI here]!
Toehold riboregulators in SynORI
Toehold switches together with their corresponding RNA triggers and split antibiotic genes completes the dynamic SynORI selection system. The switches lock the translation of downstream split antibiotic genes and form an AND type gate genetic circuit which functions to stably maintain multiple plasmids in the SynORI collection.
SynORI selection gene circuits for multi-plasmid systems:
• 2 plasmids
Consisting of: Two split antibiotic genes (part:BBa_K2259018 and part:BBa_K2259019)
• 3 plasmids
Consisting of: One Toehold (part:BBa_K2259014 or part:BBa_K2259015), one Trigger RNA (part:BBa_K2259016 or part:BBa_K2259017) and split neomycin antibiotic resistance genes (part:BBa_K2259018 and part:BBa_K2259019).
• 4 plasmids
Consisting of: Two Toeholds (part:BBa_K2259014 and part:BBa_K2259015), two Trigger RNAs (part:BBa_K2259016 and part:BBa_K2259017) and split neomycin antibiotic resistance genes (part:BBa_K2259018 and part:BBa_K2259019).
• 5 plasmids
Consisting of: Modified phage control system part:BBa_K2259044, two Toeholds (part:BBa_K2259014 and part:BBa_K2259015), two repressed Trigger RNAs (part:BBa_K2259042 and part:BBa_K2259043) and split neomycin antibiotic resistance genes (part:BBa_K2259018 and part:BBa_K2259019).
Two groups of Toeholds
SynORI collection introduces two Toehold sequences termed Toehold 1 and Toehold 2 which only interact with its corresponding Trigger RNA, termed Trigger 1 and Trigger 2 and display no cross interaction.
References
Toehold Switches: De-Novo-Designed Regulators of Gene Expression
Green, Alexander A. et al. Cell, Volume 159, Issue 4, 925 - 939
//collections/synori
| None |