Part:BBa_K2333403
Cloning ready protein degradation tag C (medium-strong) with double terminator This part is designed to facilitate quick, easy and reproducible cloning of protein degradation tag (pdt) C, onto an arbitrary gene, regardless of cloning method. William and Mary iGEM 2017 used pdts as a method to control gene expression speed. Utilizing this part along with results and mathematical modeling from William and Mary should enable the tuning of gene expression speed for any arbitrary protein in a circuit, without having to perform a multistep re-cloning process.See [http://2017.igem.org/Team:William_and_Mary/Results William and Mary's 2017 project] for more details
This part is one of a series of easy cloning pdt parts. Series range is from BBa_K2333401 to BBa_K2333406
Usage and Biology
Protein degradation tag C is of medium-strong strength among the 6 protein degradation tags that William and Mary 2017 characterized, and is associated with the E. Coli orthogonal protease mf-Lon (BBa_K2333011). While any mf-Lon generating part can be used alongside this tag to increase degradation rate/speed of a given protein of interest, the majority of William and Mary 2017's characterization was done using BBa_K2333434, which is a LacI regulated (IPTG inducible) mf-Lon. In cases where LacI cannot be used, the leakier Arabinose inducible mf-Lon BBa_K2333435 can be used instead. (Note, it is recommended that these parts be used on a low copy backbone such as pSB3K3)
This part contains pdt C, a double stop codon and BBa_B0015 (double terminator) in the William and Mary iGEM Universal Nucleotide Sequences (UNS) format. This enables easy cloning with Gibson Assembly, as UNS primers are designed for easy PCRs and high yield Gibson Assembly. See Torella, et. al (2013). On the interior of each UNS are BsaI cut sites, which enables Golden Gate Assembly as an alternative to Gibson Assembly. For groups that want to use restriction enzyme cloning, or a different Golden Gate enzyme/overhang sequence, we recommend that they PCR using the primers below, and add on up to 30 basepairs of overhang.
Since this part contains both a double stop codon and a double terminator, to tag an arbitrary protein all that is required is to append this part without UNS2 to the end of your protein of choice. (Note, that the double stop codons of your protein should be removed, as this will prevent translation of the tag.)
Primers and Cloning Information
As the intent of these parts is to be as easy to clone as possible, we've included some information that might be useful. To clone a pdt onto an arbitrary protein of interest, either digest with BsaI as part of a Golden Gate Assembly reaction or perform overhang PCR with the pdt fwd and BBa_B0015 reverse, and your overhangs of choice. These can either be restriction cut sites, your overlap sites for Gibson Assembly, or anything else. Remember that you need to remove stop codons from your gene before adding on this tag, and that restriction cut sites should have extra bases added on to allow for effective cutting
The primers below should be useful for cloning purposes. They each are short enough that 20+ basepairs of overhang can be added on, have annealing temperatures in Q5 greater than 60C, and have no significant homo-dimers, hairpins or hetero-dimers. UNS2 F and UNS3 R can be used for sequencing, or amplification to move parts to a new plasmid backbone. Since all of the protein degradation tags have the same first 33 base pairs, the Protein Degradation Primer can be used for any of the pdts in this part series. While these parts should be useful for any group using Gibson Cloning (either in or not in the W&M UNS backbone), they can also be used to add any arbitrary restriction site as well. Using the pdt F and B0015 R primers with restriction site overhangs added on should work robustly, as W&M 2017's used variants of this method to clone most of their tagged reporters. See [http://2017.igem.org/Team:William_and_Mary/Parts here] for a complete list.
Primer Name | Sequence |
---|---|
Protein Degradation Primer, Foward: | GCTGCTAACAAAAACGAAGAAAACAC |
UNS2 Primer, Forward: | GCTGGGAGTTCGTAGACG |
UNS3 Primer, Reverse: | CGACCTTGATGTTTCCAGTG |
End B0015 Primer, Reverse: | tataaacgcagaaaggccca |
Double stop + B0015 beginning, Forward: | TAATAAccaggcatcaaataaaacg |
Characterization
W&M 2017 characterized this tag's degradation rate and speed change effects as part of their iGEM project. The graphs below show this data along with the data from the other tags in this series Graph 1 Graph 2
None |