Part:BBa_K2323002

TEV protease with N-terminal 6x His-Tag under the control of the pT7 promoter

Introduction

TEV protease is a highly specific cysteine protease from the Tobacco Etch Virus. An improvement over BBa_K1319008, the protease can be expressed in strains with T7-polymerase and then purified with the help of the His-TAg for synthetic in-vitro circuits.

Sequence and Features

Assembly Compatibility:

• 10
  COMPATIBLE WITH RFC[10]
• 12
  COMPATIBLE WITH RFC[12]
• 21
  COMPATIBLE WITH RFC[21]
• 23
  COMPATIBLE WITH RFC[23]
• 25
  INCOMPATIBLE WITH RFC[25]

  Illegal NgoMIV site found at 71
  Illegal AgeI site found at 803
  
• 1000
  COMPATIBLE WITH RFC[1000]

Usage and Biology

The (+)-strand RNA genomes are often translated by the host to polyprotein precursors, which are then co-translationally cleaved by therefore provided proteases into the mature proteins. One of these proteases was found in the plant pathogenic Tobacco Etch Virus (TEV). For scientists the TEV protease is a molecular tool to cleave of all sorts of protein tags precisely due to its sequence specificity. It recognizes the amino acid sequence Glu-Asn-Leu-Tyr-Gln-Ser and cleaves then between glutamic acid and serine. In our project, the TEV protease is a main component in the Intein-Extein readout, but also was used in the purification procedure of our Cas13a proteins [http://www.jbc.org/content/277/52/50564.long].

For scientists the TEV protease is a molecular tool to cleave of all sorts of protein tags precisely due to its sequence specificity. It recognizes the amino acid sequence Glu-Asn-Leu-Tyr-Gln-Ser and cleaves then between glutamic acid and serine. In our project, the TEV protease is a main component in the Intein-Extein readout, but also was used in the purification procedure of our Cas13a proteins. We improved the Biobrick BBa_K1319008 by adding a 6x His-tag, which made it possible to purify this protease.

Error creating thumbnail: File missing

The TEV plasmid map shows the binding sites of the overhang primers. Indicated are also coding sequence, terminator, T7 promotor and RBS.

Cloning, expression and Purification

The His-tag was added to pSB1C3-BBa-K1319008 by PCR with overhang primers p-TEV-His-fwd and p-TEV-His-rev.

Name	5'-3' primers sequences
p-TEV-His-fwd	catcatcaccatcaccacgccggcggcgaaagc
p-TEV-His-rev	catctagtatttctcctctttctctagtatctccc

After PCR we ligated the plasmid using the T4 ligase. This sample was then transformed in E. coli DH5&alpha for plasmid storage and E. coli BL21star for protein expression. We expressed the TEV protease in 2xYT medium and purified it via affinity and size exclusion chromatography.

Figure 1: Fermentation of E. coli KRXwith BBa_K863005 (ECOL) in an Infors Labfors Bioreactor, scale: 3 L, [http://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#Autoinduction_medium autoinduction medium] + 60 µg/mL chloramphenicol, 37 °C, pH 7, agitation on cascade to hold pO₂ at 50 %, OD₆₀₀ measured every 30 minutes.

Figure 1: Fermentation of E. coli KRXwith BBa_K863005 (ECOL) in an Infors Labfors Bioreactor, scale: 3 L, [http://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#Autoinduction_medium autoinduction medium] + 60 µg/mL chloramphenicol, 37 °C, pH 7, agitation on cascade to hold pO₂ at 50 %, OD₆₀₀ measured every 30 minutes.

After the positive measurement of activity of ECOL we made a scale-up and fermented E. coli KRX with BBa_K863005 in an Infors Labfors fermenter with a total volume of 3 L. Agitation speed, pO₂ and OD₆₀₀ were determined and illustrated in Figure 1. The exponential phase started after 1.5 hours of cultivation. The cell growth caused a decrease in pO₂. After 2 hours of cultivation the agitation speed increased up to 629 rmp (5.9 hours) to hold the minimal pO₂ level of 50 %. Then, after 4 hours there was a break in cell growth due to induction of protein expression. The maximal OD₆₀₀ of 2.78 was reached after 5 hours. In comparison to E. coli KRX (OD_600,max =4.86 after 8.5 hours) and to E. coli KRX with BBa_K863000 (OD_600,max =3.53 after 10 hours, time shift due to long lag phase) the OD_{600 max} is lower. In the following hours, the OD₆₀₀ and the agitation speed decreased and the pO₂ increased, which indicates the death phase of the cells. This is caused by the cell toxicity of ECOL (reference: [http://www.dbu.de/OPAC/ab/DBU-Abschlussbericht-AZ-13191.pdf DBU final report]). Hence, cells were harvested after 12 hours.