Collections/Best Composite Part

Revision as of 19:05, 17 May 2017 by Vinoo (Talk | contribs)

This collection is under curation by iGEM HQ. New parts and information are currently being added to this page.

A composite part is a functional unit of DNA consisting of two or more basic parts assembled together. Generally, the Best Composite Part Award is given to a "device," a composite part that can function independently, without the need for further assembly. The iGEM community can improve upon these devices, use them as part of their designs, and/or use them as a foundation for new devices.

The following collection contains parts (and teams) that won, or were nominated, for the Best Composite Part award. Generally, these parts:

  • are novel and/or provide a useful function
  • are highly documented and characterized, with data and visualizations that show they work as expected
  • adhere to the iGEM competition's requirements and the Registry's requirements for submissions


More...
NameDescriptionTypeCreated bylengthusesseq
BBa_K1658000Cinnamyl alcohol dehydrogenase CAD1CompositeŞeniz Yksel, Burak Kızıl1231  . . . tttatctgttgtttgtcggtgaacgctctc
BBa_K1689010 N-luc-dCas9CompositeZHANG Yihao56301 . . . ctgatgtcaagcgtgtacgaatttgataat
BBa_K1758377Biosensor device for detection of GHB and GBLCompositeTeam Bielefeld-CeBiTec 20151863  . . . aagcttgggtaccgatcgcagaaagactaa
BBa_K1890002Silicatein gene, fused to transmembrane domain of OmpA, with strong RBSCompositeLycka Kamoen, Maria Vazquez1481  . . . gctagtgatgcctcctaccccactctctag
BBa_K1991009Pcons-RBS-LO-AOX2-HisCompositeChen, Pei-En2662  . . . aggggttttttgctgaaaggaggaactata
BBa_K1993009CXCR4-T2A-Luciferase-IRES-eGFPCompositeSu Xiaojun3366  . . . actctcggcatggacgagctgtacaagtaa
BBa_K2206006 Toehold switch for hsa-miR-15b-5p with GFPmut3b and inducible promoterCompositeSammy Lovat2014  . . . catggcatggatgaactatacaaataataa
BBa_K2259091SynORI inducible plasmid copy number deviceCompositeLaurynas Karpus925  . . . accgttggtagcggtggtttttttgtttgc
BBa_K2306008Secretory-abundant heat soluble protein 33020 "SAHS 33020" (T7 promoter, RBS and double terminator)CompositeGuillermo Serena Ruiz736  . . . caccttcgggtgggcctttctgcgtttata
BBa_K2753018TALE2 sp1CompositeWEI KUANGYI 3166  . . . tcagaccggaaagcacatccggtgacagct
BBa_K2770002ycdW generatorGeneratorLuca Brenker, Peter Gockel, Maria Musillo, Elena Nickels, Jan Benedict Spannenkrebs1060  . . . catcaccatcaccatcatcatcatcattaa
BBa_K2796028Exosome boosterCodingShuangshuang Pu38742 . . . tcccccggcaatcattacataaacagataa
BBa_K2932003PliaI + RBS + CA + terminatorCompositePing-Yi Chen1173  . . . caccttcgggtgggcctttctgcgtttata
BBa_K2980009CIB1-GCN(4)-mEGFP-FUSLCDCodingJi Gao1713  . . . atcactctcggcatggacgagctgtacaag
BBa_K3187000P22 Bacteriophage Coat Protein with LPETGG Tag for Sortase-mediated LigationCompositeiGEM TU_Darmstadt 20191650  . . . tccggattggcgaatgggacgcgccctgta
BBa_K3352006T7 + RBS SplintR Ligase Expressing ConstructCompositeHannah Hsu1124-1 . . . caccttcgggtgggcctttctgcgtttata
BBa_K3370601T7 promoter + LacO + RBS + Harmonized GR with linker and GFP + 6x His-tag + TerminatorCompositeCHIH-LU CHIANG1877-1 . . . gactgtccacgacgctatacccaaaagaaa
BBa_K3407022Short hairpin RNA (shRNA) potential trigger of RNAi. Transcription controlled under T7 promoter.CompositeJavier Navarro Delgado87-1 . . . tgtaggtggcatcgccctcgccctcgccgg
BBa_K3512042Atmosphere Regulated KillswitchDeviceGourav Saha958-1 . . . caccttcgggtgggcctttctgcgtttata
BBa_K3758301T7 Universal Test Construct 7.0T7Michael Burgis823-1 . . . cccggtaggggcccacgcttgttggagacg
BBa_K3893030Population control device (QS-based lysis protein oscilator)CompositeStefania Soledad Montesinos Ludena3200-1 . . . ttcgggtgggcctttctgcgtttatacgct
BBa_K4011008CBM3-NT2RepCT-CBM3CodingZixiang Zhou1995-1 . . . aatggtgttctggtttggggtaaagaaccg
BBa_K4150006T7P-g10.RBS-His-Ova-T7TCompositeWEI CHIEH CHIN1363-1 . . . gcctctaaacgggtcttgaggggttttttg
BBa_K4156101pLldR RegulatoryZheng Huang1361-1 . . . gcacatccggtgacagctaaagaggagaaa
BBa_K4239008fiatlux genes with their promoter to emit luminescenceTranslational_UnitGuillaume FULCONIS5867-1 . . . ttaagcttaaccgaagcgtttgatagttga
BBa_K4735014NarK promoter fused to sfGFPCompositeAsha Keshavarz980-1 . . . tttatctgttgtttgtcggtgaacgctctc
BBa_K4735015dmsA promoter driving superfolder GFP expressionCompositeAsha Keshavarz979-1 . . . tttatctgttgtttgtcggtgaacgctctc