Part:BBa_K1926003
A cyclic promoter of CDK4 from human genome
| Promoter of CDK4 | |
|---|---|
| BioBrick No. | BBa_K1926003 |
| RFC standard | RFC 10 |
| Requirement | pSB1C3 |
| Source | Addgene |
| Submitted by | [http://2016.igem.org/Team:SYSU-CHINA SYSU-CHINA 2016] |
Contents
Function and Biology
This part is a cyclic promoter named CDK4 from human genome. It can lead to transcription of the downstream DNA sequence in every G1 phase[1].
Design Considerations
The sequence was retrieved from Addgene. We got it from human genome through PCR using the following primers (details in Figure1):
pCDK4-F: TGGTGGAGCGAAAAGGTGACAGCATC
pCDK4-R: GCGGAAACTGGGAGGGCGGGGCGAA
Owing to the fact that CDK4 promoter is a eukaryotic promoter, eukaryotic vector is needed to insert it into cell genome. The tet-on vector we chose to use for our project, which comes from our host lab, had Sph1 and Xho1 restriction sites. With the two sites we can cut off the primary PGK promoter of the vector. Therefore, we add Sph1 and Xho1 sequence to the primers in figure1, digest PCR product with enzyme Sph1 and Xho1 and insert the digested parts into the tet-on vector which also digested by Sph1 and Xho1 in order to replace the PGK promoter with the CDK4 promoter (Figure 2).
A better way to construct biobricks shorter than 1kb
When we need to construct biobricks, the first thing we need to do is to add the prefix and suffix to our parts. However, both prefix and suffix have 22bp in length with high GC%, which is unfriendly for PCR because the matching region of the primer with the part should be no shorter than the unmatching tail. As a result, the primers would be no shorter than 44bp in total length, accompanied by a huge Tm. If the GC% of the parts matching region is also high (such as the part is in a promoter in this case), the situation will become even worse. To address this problem, we decided to Add XbaI at the 5’ region of the part and SpeI at the 3’ region by PCR with a pair of “short” primers (Promoter-Fs and -Rs). For control, we also design a pair of “long” ones (Promoter-Fl and -Rl).
Promoter-Fs: 5’-TTCTAGAG - CAGTTTGGACTAGCATTCTA -3’
Promoter-Rs: 5’-TACTAGTA - ATATCATTTTACGTTTCTCG-3’
Promoter-Fl: 5’-GAATTCGCGGCCGCTTCTAGAG - CAGTTTGGACTAGCATTCTA -3’
Promoter-Rl: 5’- CTGCAGCGGCCGCTACTAGTA - ATATCATTTTACGTTTCTCG -3'
(before the ‘-’ is the unmatching tail while after the ‘-’ is the matching region)
With the “short” primers, we successfully construct two biobricks in this part collection (all G1 cyclic promoters, from Part:BBa_K1926001 to Part:BBa_K1926003) through the following protocol:
1. Add XbaI at the 5’ region of the part and SpeI at the 3’ region by PCR.
2. Digest pSB1C3 and the PCR product with XbaI and SpeI enzyme. Follow the instruction of the enzyme protocol.
3. Treat the digested pSB1C3 with alkaline phosphatase, which can remove the phosphate group of the cohesive ends of the backbone. Follow the instruction of the enzyme protocol.
4. Ligate the digested part and the digested-treated backbone, and transform into E.coli.
5. Product confirmation: After plasmid extraction, use enzyme XbaI digest the plasmid, of use Xbal and SpeI to digest the plasmid.
(See details and explanations of this protocol here [http://2016.igem.org/Team:SYSU-CHINA/Measurement/InnovativeBioBrickConstruction SYSU-CHINA 2016 Measurement])
For the “long” primers, we failed to use the Takara PrimerSTAR Max DNA Polymerase to get PCR products. When we change to use the expensive and tardy KOD enzyme in our host lab, we finally succeeded in having bands on our AGE image. Therefore, although with the “long” primers we can also construct biobricks, we think that for parts shorter than 1kb, our new protocol with the “short” primers is a better and cheaper choice.
Gel analysis after EcoR1 digestion
The length of our biobricks are confirmed by gel analysis after EcoR1 digestion. The biobrick BBa_R0040, which is the negative control in 2016’s interlab, was used as a control because it only have a 54 bp part.
Promoter function confirmation
G1 promoter function confirmation by transient transfection using 293T cells. Photos taken 48 hours after transient transfection, 10x. pCDK4, pKi67 and pCCNE are our G1 promoters. pmPGK is the constitutive promoter of mouse PGK, it is a medium promoter, here used as a control.
G1 promoter characteristic confirmation
Stable G1 promoter-SNAP 293T cells were built. Cells were treated with duel-thymidine block, and during the second release, reagents were added and samples were collected to carry out the confirmation.
293T cells were arrested at G1/S phase with duel-thymidine. Cells were treated with 5μM SNAP-tag substrate, imaged and collected at 2h, 5h and 18h after the second release. After sample collection at 2h, 10μM SNAP-Cell Block were added to the rest of the wells to block existing SNAP-tag.
SNAP were detected using microscope, and flow cytometry analysis was accordingly carried out to confirm the state of the cells, and the cell cycle of wild type 293T cells served as experimental control (Figure 5).
At 2h, most pCCNE-SNAP and pKi67-SNAP cells were at G1/S phase and most pCDK4-SNAP cells were at G0/G1 phase (Figure 6 g-i). SNAP-tag expression was detected (Figure 6 d-f).
At 5h, the majority of the three cells were at late S phase (Figure 7 g-i). Cells were blocked with SNAP-Cell Block at 2h, and at 5h, we didn't observe SNAP-tag expression (Figure 7 d-f), which means there were no SNAP-tag expression during S phase.
At 18h, the cells were again at G0/G1 phase (Figure 8 g-i), and SNAP-tag was again detected, which means SNAP-tag was expressed during G1 phase.
From the results, it could be confirmed that three G1 promoters of pCDK4, pKi67 and pCCNE work once a cell cycle during G1/S phase.
Needed to be pointed that, SNAP-tag fusion protein locates at cell membrane. In 2h and 18h result Figure 6 d-f and Figure 8 d-f, fluorescence mainly focus on boundary between cells, and a cell is shown as an empty area surrounded by fluorescence. Comparing with 5h result, in which all SNAP-tag are block and no fluorescence is detected, we believe that the fluorescence shows SNAP-fusion protein on cell membrane rather than residual SNAP substrate.
Moreover, the SNAP-tag fusion protein degrades at a certain rate. The results from 2h and 18h (Figure 6 d-f, Figure 8 d-f) show different fluorescence intensity at G0/G1 phase and G1/S phase. We believe that the different proportion of G1 cells led to different SNAP expression rate, and consequently led to different fluorescence intensity, which also confirms that the SNAP-tag fusion protein degrade at a certain rate.
Use this part in your project!
You may use this part to:
1) Express something in mammal cell lines particularly in G1 phases or once in every cell cycle by stable transfecting it into cell line;
2) Use it as a human promoter by transient transfecting it into cells.
You may also choose two other G1 promoters in this part collection we submitted: Part:BBa_K1926001 and Part: BBa_K1926003.
Reference
1. Koff, A., et al., Human cyclin E, a new cyclin that interacts with two members of the CDC2 gene family. Cell, 1991. 66(6): p. 1217-1228.
2. Hwang, H.C. and B.E. Clurman, Cyclin E in normal and neoplastic cell cycles. Oncogene, 2005. 24(17): p. 2776-86.
3. Ohtani, K., J. DeGregori, and J.R. Nevins, Regulation of the cyclin E gene by transcription factor E2F1. Proc Natl Acad Sci U S A, 1995. 92(26): p. 12146-50.
Sequence and Features
- 10COMPATIBLE WITH RFC[10]
- 12INCOMPATIBLE WITH RFC[12]Illegal NotI site found at 382
Illegal NotI site found at 497 - 21INCOMPATIBLE WITH RFC[21]Illegal BamHI site found at 529
Illegal XhoI site found at 1050 - 23COMPATIBLE WITH RFC[23]
- 25INCOMPATIBLE WITH RFC[25]Illegal NgoMIV site found at 273
Illegal NgoMIV site found at 313
Illegal NgoMIV site found at 491 - 1000COMPATIBLE WITH RFC[1000]
//collections
//promoter
| None |