![](https://parts.igem.org/images/partbypart/icon_coding.png)
Part:BBa_K2040122
mRFP1 + TtrpC
A SV40 nuclear localization signal was fused to the phototoxic protein KillerRed.
Usage and Biology
KillerRed(BBa_K1184000) is a red fluorescent protein that produces reactive oxygen species (ROS) in the presence of yellow-orange light (540-585 nm). KillerRed is engineered from anm2CP to be phototoxic. Expression of KillerRed and irradiation with light may act a kill-switch for biosafety applications. More details about KillerRed see [http://2013.igem.org/Team:Carnegie_Mellon/KillerRed 2013 Carnegie_Mellon].
KillerRed effectively killed bacterial cells when exposed to white light for several minutes. However, in eukaryotic cells, irradiation of KillerRed localized in cell cytosol has a weak effect on cell survival[2]. The following two ways have been found to be effective for killing the eukaryotic cells using KillerRed: (1) via an apoptotic pathway using KillerRed targeted to mitochondria, and (2) via membrane lipid oxidation using membrane-localized KillerRed. [2] Surely, one should select some ROS-sensitive intracellular localizations, such as mitochondria, plasma membrane, or chromatin to increase efficiency of KillerRed-mediated oxidative stress. So we tried to fused a SV40 nuclear localization signal(5' CCTCCCAAGAAGAAGCGCAAGGTC 3') to the KillerRed protein in order to let it locate in the nucleus containing chromatin.
We used __ cell to do this experiment.
References
[1]2013 Carnegie_Mellon ;http://2013.igem.org/Team:Carnegie_Mellon/KillerRed
[2]Genetically-encoded photosensitizer KillerRed; http://evrogen.com/products/KillerRed/KillerRed_Detailed_description.shtml
Sequence and Features
- 10COMPATIBLE WITH RFC[10]
- 12COMPATIBLE WITH RFC[12]
- 21INCOMPATIBLE WITH RFC[21]Illegal BamHI site found at 715
- 23COMPATIBLE WITH RFC[23]
- 25INCOMPATIBLE WITH RFC[25]Illegal NgoMIV site found at 1351
Illegal AgeI site found at 555
Illegal AgeI site found at 667 - 1000INCOMPATIBLE WITH RFC[1000]Illegal BsaI.rc site found at 1065
//biosafety/kill_switch
//cds/reporter/rfp
//function/celldeath
//function/reporter/fluorescence
color | Red |
control | BBa_E1010 as a negative control |
emission | 611 nm |
excitation | 545-585 nm |
function | Phototoxicity |
origin | Engineered from anm2CP |
output | Superoxide radical anion |
target | Nucleus |