Part:BBa_C0062:Experience

This experience page is provided so that any user may enter their experience using this part.
Please enter how you used this part and how it worked out.

User Reviews

UNIQ7b2927c0916f12a1-partinfo-00000000-QINU

•••• ETH Zurich 2014

Characterization of two-order crosstalk Background information System considered Modeling crosstalk First-order crosstalk First Level crosstalk: LuxR binds to different HSL and activates the promoter Plux Second Level crosstalk: LuxR binds to 3OC6-HSL, its natural HSL, and activates different promoter Second order crosstalk: Combination of both cross-talk levels Other regulatory proteins, like LuxR, bind to different HSL and activates the promoter. Results

••••• SUN(Tsinghua)

Part was sequenced and functional. LuxR was used in our Portable Pathogen Detector.

;

••••• wmholtz

Using this part, I have successfully constructed and tested a quorum sensing circuit in E. coli.

;

••••• Youri

This part was used and tested as a subpart in K546000, K546001, K546002, K546003, K546005 and K546546. This part functioned in all cases.

;

Kevin (iGEM Braunschweig 2013)

The plasmid pSB1C3 BBa_C0062 from the 2013 distribution Kit was transformed in E. coli XL1 BlueMRF. Sequencing with standard verification primer VF2 confirmed matching sequence of backbone DNA up to the EcoRI restriction site. The rest of the sequence (not shown) does not match the registry entry. 96 145 pSB1C3 LuxR (96) GAGGCAGAATTTCAGATAAAAAAAATCCTTAGCTTTCGCTAAGGATGATT C0062 VF2 (1) GAGGCAGAATTTCAGATAAAAAAAATCCTTAGCTTTCGCTAAGGATGATT 146 195 pSB1C3 LuxR (146) TCTGGAATTCGCGGCCGCTTCTAGAGATGAAAAACATAAATGCCGACGAC C0062 VF2 (51) TCTGGAATTCGACGCAA-TGGGTGCGCTGTCTACTAAATACAACGACACC 196 245 pSB1C3 LuxR (196) ACATACAGAATAATTAATAAAATTAAAGCTTGTAGAAGCAATAATGATAT C0062 VF2 (100) CCGGAAAAAGCCTCCCGTACTTACGACGCTCACCGTGACGGTTTCGTTAT 246 pSB1C3 LuxR (246) TAATCAATGC... C0062 VF2 (150) CGCTGGCGGC... A restriction assay (Figure 1) showed that the sequenced part has no XbaI restriction site following the EcoRI site indicating another part in front of BBa_C0062 with a length of at least 1000 bp.

;

UNIQ7b2927c0916f12a1-partinfo-00000007-QINU