Promoters/Catalog/B. subtilis/Constitutive

Revision as of 19:10, 25 June 2014 by Vinoo (Talk | contribs)

ConstitutivePromoter.png

The promoters here are B. subtilis promoters that are constitutive meaning that the activity of these promoters should only be regulated by the levels of RNA polymerase and the appropriate σ factor.

The sequence of these promoter are adapted to the σ factor of B. subtilis. However, some of these promoter also works in E. coli. Generally speaking, standard E. coli promoters don't work (or are very weak) in B. subtilis strains, whereas the contrary generally works. However, it doesn't mean that the efficiency will be the same in both strains. The pVeg promoter, for instance, works fine at a high level of expression in both E. coli and B. subtilis strains - Contribution from User: Cyrpaut (31 October 2011)

Constitutive B. subtilis σA promoters

This section lists promoters that are recognized by B. subtilis σA RNAP. σA is the major B. subtilis sigma factor so there should be RNAP present to transcribe these promoters under most growth conditions (although maximally during exponential growth).


More...
NameDescriptionPromoter SequencePositive
Regulators
Negative
Regulators
LengthDocStatus
BBa_K143012Promoter veg a constitutive promoter for B. subtilis . . . aaaaatgggctcgtgttgtacaataaatgt976561In stock
BBa_K143013Promoter 43 a constitutive promoter for B. subtilis . . . aaaaaaagcgcgcgattatgtaaaatataa5611873Not in stock
BBa_K780003Strong constitutive promoter for Bacillus subtilis . . . aattgcagtaggcatgacaaaatggactca361559It's complicated
BBa_K823000PliaG . . . caagcttttcctttataatagaatgaatga1217765In stock
BBa_K823002PlepA . . . tctaagctagtgtattttgcgtttaatagt1577245In stock
BBa_K823003Pveg . . . aatgggctcgtgttgtacaataaatgtagt23714126In stock

Constitutive B. subtilis σB promoters

This section lists promoters that are recognized by B. subtilis σB RNAP. σB is the major stationary phase E. coli sigma factor. Use these promoters when you want high promoter activity during stationary phase or during starvation.


More...
NameDescriptionPromoter SequencePositive
Regulators
Negative
Regulators
LengthDocStatus
BBa_K143010Promoter ctc for B. subtilis . . . atccttatcgttatgggtattgtttgtaat564297Not in stock
BBa_K143011Promoter gsiB for B. subtilis . . . taaaagaattgtgagcgggaatacaacaac382765Not in stock
BBa_K143013Promoter 43 a constitutive promoter for B. subtilis . . . aaaaaaagcgcgcgattatgtaaaatataa5611873Not in stock