Coding

Part:BBa_K1159004

Designed by: TU Munich 2013   Group: iGEM13_TU-Munich   (2013-09-14)
Revision as of 13:37, 8 October 2013 by JohannaB (Talk | contribs)

Human protein phosphatase 1 (PP1) in RFC[25]

Human protein phosphatase 1 binds the toxic oligopeptide produces by gree-blue algae. This part is flanked by RFC[25] pre- and suffix.

<style type="text/css">table#AutoAnnotator {border:1px solid black; width:100%; border-collapse:collapse;} th#AutoAnnotatorHeader { border:1px solid black; width:100%; background-color: rgb(221, 221, 221);} td.AutoAnnotator1col { width:100%; border:1px solid black; } span.AutoAnnotatorSequence { font-family:'Courier New', Arial; } td.AutoAnnotatorSeqNum { text-align:right; width:2%; } td.AutoAnnotatorSeqSeq { width:98% } td.AutoAnnotatorSeqFeat1 { width:3% } td.AutoAnnotatorSeqFeat2a { width:27% } td.AutoAnnotatorSeqFeat2b { width:97% } td.AutoAnnotatorSeqFeat3 { width:70% } table.AutoAnnotatorNoBorder { border:0px; width:100%; border-collapse:collapse; } table.AutoAnnotatorWithBorder { border:1px solid black; width:100%; border-collapse:collapse; } td.AutoAnnotatorOuterAmino { border:0px solid black; width:20% } td.AutoAnnotatorInnerAmino { border:1px solid black; width:50% } td.AutoAnnotatorAminoCountingOuter { border:1px solid black; width:40%; } td.AutoAnnotatorBiochemParOuter { border:1px solid black; width:60%; } td.AutoAnnotatorAminoCountingInner1 { width: 7.5% } td.AutoAnnotatorAminoCountingInner2 { width:62.5% } td.AutoAnnotatorAminoCountingInner3 { width:30% } td.AutoAnnotatorBiochemParInner1 { width: 5% } td.AutoAnnotatorBiochemParInner2 { width:55% } td.AutoAnnotatorBiochemParInner3 { width:40% } td.AutoAnnotatorCodonUsage1 { width: 3% } td.AutoAnnotatorCodonUsage2 { width:14.2% } td.AutoAnnotatorCodonUsage3 { width:13.8% } td.AutoAnnotatorAlignment1 { width: 3% } td.AutoAnnotatorAlignment2 { width: 10% } td.AutoAnnotatorAlignment3 { width: 87% } td.AutoAnnotatorLocalizationOuter {border:1px solid black; width:40%} td.AutoAnnotatorGOOuter {border:1px solid black; width:60%} td.AutoAnnotatorLocalization1 { width: 7.5% } td.AutoAnnotatorLocalization2 { width: 22.5% } td.AutoAnnotatorLocalization3 { width: 70% } td.AutoAnnotatorGO1 { width: 5% } td.AutoAnnotatorGO2 { width: 35% } td.AutoAnnotatorGO3 { width: 60% } td.AutoAnnotatorPredFeat1 { width:3% } td.AutoAnnotatorPredFeat2a { width:27% } td.AutoAnnotatorPredFeat3 { width:70% } div.AutoAnnotator_trans { position:absolute; background:rgb(11,140,143); background-color:rgba(11,140,143, 0.8); height:5px; top:100px; } div.AutoAnnotator_sec_helix { position:absolute; background:rgb(102,0,102); background-color:rgba(102,0,102, 0.8); height:5px; top:110px; } div.AutoAnnotator_sec_strand { position:absolute; background:rgb(245,170,26); background-color:rgba(245,170,26, 1); height:5px; top:110px; } div.AutoAnnotator_acc_buried { position:absolute; background:rgb(89,168,15); background-color:rgba(89,168,15, 0.8); height:5px; top:120px; } div.AutoAnnotator_acc_exposed { position:absolute; background:rgb(0, 0, 255); background-color:rgba(0, 0, 255, 0.8); height:5px; top:120px; } div.AutoAnnotator_dis { position:absolute; text-align:center; font-family:Arial,Helvetica,sans-serif; background:rgb(255, 200, 0); background-color:rgba(255, 200, 0, 1); height:16px; width:16px; top:80px; border-radius:50%; } </style>
Protein data table for BioBrick <a href="https://parts.igem.org/wiki/index.php?title=Part:BBa_">BBa_</a> automatically created by the <a href="http://2013.igem.org/Team:TU-Munich/Results/AutoAnnotator">BioBrick-AutoAnnotator</a> version 1.0
Nucleotide sequence in RFC 25 N-Part using the stop codon in the suffix, so ACCGGT was added (in italics) to the 3' end: (underlined part encodes the protein)
 GGATCCGCGGATTTAGATAAACTCAACATCGACAGCATTATCCAACGGCTGCTGGAAGTGAGAGGGTCCAAGCCTGGTAAGAATGTCCAGC ... TTCAGGAGAACCGGT
 ORF from nucleotide position 83 to 106 (excluding stop-codon)
Amino acid sequence: (RFC 25 scars in shown in bold, other sequence features underlined; both given below)
MSSFRRTG*
Sequence features: (with their position in the amino acid sequence, see the <a href="http://2013.igem.org/Team:TU-Munich/Results/Software/FeatureList">list of supported features</a>)
None of the supported features appeared in the sequence
Amino acid composition:
Ala (A)0 (0.0%)
Arg (R)2 (25.0%)
Asn (N)0 (0.0%)
Asp (D)0 (0.0%)
Cys (C)0 (0.0%)
Gln (Q)0 (0.0%)
Glu (E)0 (0.0%)
Gly (G)1 (12.5%)
His (H)0 (0.0%)
Ile (I)0 (0.0%)
Leu (L)0 (0.0%)
Lys (K)0 (0.0%)
Met (M)1 (12.5%)
Phe (F)1 (12.5%)
Pro (P)0 (0.0%)
Ser (S)2 (25.0%)
Thr (T)1 (12.5%)
Trp (W)0 (0.0%)
Tyr (Y)0 (0.0%)
Val (V)0 (0.0%)
Amino acid counting
Total number:8
Positively charged (Arg+Lys):2 (25.0%)
Negatively charged (Asp+Glu):0 (0.0%)
Aromatic (Phe+His+Try+Tyr):1 (12.5%)
Biochemical parameters
Atomic composition:C38H64N14O12S1
Molecular mass [Da]:941.1
Theoretical pI:12.00
Extinction coefficient at 280 nm [M-1 cm-1]:0 / 0 (all Cys red/ox)
Plot for hydrophobicity, charge, predicted secondary structure, solvent accessability, transmembrane helices and disulfid bridges <input type='button' id='hydrophobicity_charge_button' onclick='show_or_hide_plot_1381239371380()' value='Show'>
Codon usage
Organism:E. coliB. subtilisS. cerevisiaeA. thalianaP. patensMammals
Codon quality (<a href="http://en.wikipedia.org/wiki/Codon_Adaptation_Index">CAI</a>):good (0.63)acceptable (0.59)good (0.65)good (0.68)excellent (0.88)excellent (0.91)
Alignments (obtained from <a href='http://predictprotein.org'>PredictProtein.org</a>)
   There were no alignments for this protein in the data base. The BLAST search was initialized and should be ready in a few hours.
Predictions (obtained from <a href='http://predictprotein.org'>PredictProtein.org</a>)
   There were no predictions for this protein in the data base. The prediction was initialized and should be ready in a few hours.
The BioBrick-AutoAnnotator was created by <a href="http://2013.igem.org/Team:TU-Munich">TU-Munich 2013</a> iGEM team. For more information please see the <a href="http://2013.igem.org/Team:TU-Munich/Results/Software">documentation</a>.
If you have any questions, comments or suggestions, please leave us a <a href="http://2013.igem.org/Team:TU-Munich/Results/AutoAnnotator">comment</a>.

<script type='text/javascript' src='http://code.jquery.com/jquery-1.10.0.min.js'></script><script type='text/javascript' src='http://2013.igem.org/Team:TU-Munich/Flot.js?action=raw&ctype=text/js'></script><script>function show_or_hide_plot_1381239371380(){hydrophobicity_datapoints = [[2.5,-0.28],[3.5,-1.56],[4.5,-1.54],[5.5,-1.46]];charge_datapoints = [[2.5,0.20],[3.5,0.40],[4.5,0.40],[5.5,0.40]];dis_datapoints = undefined;trans_datapoints = undefined;sec_helix_datapoints = undefined;sec_strand_datapoints = undefined;acc_exposed_datapoints = undefined;acc_buried_datapoints = undefined;flot_plot_options = []; flot_plot_options[0] = {grid: {borderWidth: {top: 0,right: 0,bottom: 0,left: 0}},legend: {show: false},xaxes: [{show: true,min: 0,max: 200,ticks: [[0.5, '1'], [24.5, '25'], [49.5, '50'], [74.5, '75'], [99.5, '100'], [124.5, '125'], [149.5, '150'], [174.5, '175'], [199.5, '200']],tickLength: -5}],yaxes: [{show: true,ticks: [[0, '0'], [4.5,'hydro-
phobic  '], [-4.5,'hydro-
philic  ']],min: -4.5,max: +4.5,font: {size: 12,lineHeight: 14,style: 'italic',weight: 'bold',family: 'sans-serif',variant: 'small-caps',color: 'rgba(100,149,237,1)'}},{show: true,ticks: [[0, ], [1,'positive
 charge'], [-1,'negative
 charge']],position: 'right',min: -1,max: 1,font: {size: 12,lineHeight: 14,style: 'italic',weight: 'bold',family: 'sans-serif',variant: 'small-caps',color: 'rgba(255,99,71,1)'}}]};number_of_plots = 1;for ( plot_num = 1 ; plot_num < number_of_plots ; plot_num ++){flot_plot_options[plot_num] = $.extend(true, {} ,flot_plot_options[0]);flot_plot_options[plot_num].xaxes = [{min: plot_num*200,max: (plot_num + 1)*200,ticks: [ [plot_num*200 + 0.5, (plot_num*200 + 1).toString()], [plot_num*200 + 24.5, (plot_num*200 + 25).toString()], [plot_num*200 + 49.5, (plot_num*200 + 50).toString()], [plot_num*200 + 74.5, (plot_num*200 + 75).toString()], [plot_num*200 + 99.5, (plot_num*200 + 100).toString()], [plot_num*200 + 124.5, (plot_num*200 + 125).toString()], [plot_num*200 + 149.5, (plot_num*200 + 150).toString()], [plot_num*200 + 174.5, (plot_num*200 + 175).toString()], [plot_num*200 + 199.5, (plot_num*200 + 200).toString()] ],tickLength: -5}];};try {if( $('#AutoAnnotator_container_1381239371380 #hydrophobicity_charge_button').val() =='Show' ){$('#AutoAnnotator_container_1381239371380 #hydrophobicity_charge_container').css('display','block');$('#AutoAnnotator_container_1381239371380 #hydrophobicity_charge_button').val('Hide');var description_html = '
';description_html = description_html + '
 <input type=\'checkbox\' id=\'hydrophobicity_checkbox\' checked=\'checked\'> Moving average over 5 amino acids for hydrophobicity (<img src=\'https://static.igem.org/mediawiki/2013/e/e9/TUM13_hydrophobicity_icon.png\' alt=\'blue graph\' height=\'10\'></img>)';description_html = description_html + '
 <input type=\'checkbox\' id=\'charge_checkbox\' checked=\'checked\'> Moving average over 5 amino acids for charge (<img src=\'https://static.igem.org/mediawiki/2013/3/3e/TUM13_charge_icon.png\' alt=\'red graph\' height=\'10\'></img>)';description_html = description_html + '
 <input type=\'checkbox\' id=\'dis_checkbox\' checked=\'checked\'> Predicted disulfid bridges (<img src=\'https://static.igem.org/mediawiki/2013/2/28/TUM13_dis_icon.png\' alt=\'yellow circle\' height=\'10\'></img>) with the number of the bridge in the center';description_html = description_html + '
 <input type=\'checkbox\' id=\'trans_checkbox\' checked=\'checked\'> Predicted transmembrane helices (<img src=\'https://static.igem.org/mediawiki/2013/7/78/TUM13_trans_icon.png\' alt=\'turquois bars\' height=\'10\'></img>)';description_html = description_html + '
 <input type=\'checkbox\' id=\'sec_checkbox\' checked=\'checked\'> Predicted secondary structure: Helices (<img src=\'https://static.igem.org/mediawiki/2013/b/bf/TUM13_helix_icon.png\' alt=\'violet bars\' height=\'10\'></img>) and beta-strands (<img src=\'https://static.igem.org/mediawiki/2013/b/bf/TUM13_strand_icon.png\' alt=\'yellow bars\' height=\'10\'></img>)';description_html = description_html + '
 <input type=\'checkbox\' id=\'acc_checkbox\' checked=\'checked\'> Predicted solvent accessability: Exposed (<img src=\'https://static.igem.org/mediawiki/2013/1/16/TUM13_exposed_icon.png\' alt=\'blue bars\' height=\'10\'></img>) and buried (<img src=\'https://static.igem.org/mediawiki/2013/0/0b/TUM13_buried_icon.png\' alt=\'green bars\' height=\'10\'></img>) residues';description_html = description_html + '
';$('#AutoAnnotator_container_1381239371380 #hydrophobicity_charge_explanation').html(description_html);plot_according_to_selectors_1381239371380();$('#AutoAnnotator_container_1381239371380 #AutoAnnotator_plot_selectors').find('input').click(plot_according_to_selectors_1381239371380);}else{$('#AutoAnnotator_container_1381239371380 #hydrophobicity_charge_container').css('display','none');$('#AutoAnnotator_container_1381239371380 #hydrophobicity_charge_button').val('Show');$('#AutoAnnotator_container_1381239371380 #hydrophobicity_charge_explanation').html(
);}}catch(err){txt='There was an error with the button controlling the visibility of the plot.\n';txt=txt+'The originating error is:\n' + err + '\n\n';alert(txt);}};function plot_according_to_selectors_1381239371380(){try{var plot_datasets = [[],[]];if($('#AutoAnnotator_container_1381239371380 #hydrophobicity_checkbox').prop('checked') == true){plot_datasets[0] = { color: 'rgba(100,149,237,1)',data: hydrophobicity_datapoints,label: 'Hydrophobicity',lines: { show: true, fill: true, fillColor: 'rgba(100,149,237,0.1)' },yaxis: 1};}if($('#AutoAnnotator_container_1381239371380 #charge_checkbox').prop('checked') == true){plot_datasets[1] = {color: 'rgba(255,99,71,1)',data: charge_datapoints,label: 'Charge',lines: { show: true, fill: true, fillColor: 'rgba(255,99,71,0.1)' },yaxis: 2};}for (plot_num = 0 ; plot_num < number_of_plots ; plot_num ++){$.plot('#AutoAnnotator_container_1381239371380 #hydrophobicity_charge_placeholder'+ plot_num.toString(), plot_datasets, flot_plot_options[plot_num] );}var screen_width = $('canvas.flot-base').width(); var pos_of_first_tick = 46;var pos_of_last_tick = screen_width - 51;var tick_diff = (screen_width - 97)/199;if($('#AutoAnnotator_container_1381239371380 #dis_checkbox').prop('checked') == true){for ( j = 0 ; j < dis_datapoints.length ; j++ ){$('#AutoAnnotator_container_1381239371380 #hydrophobicity_charge_placeholder' + Math.floor((dis_datapoints[j][0] - 1)/200) ).append('
' + (j+1) + '
');$('#AutoAnnotator_container_1381239371380 #hydrophobicity_charge_placeholder' + Math.floor((dis_datapoints[j][1] - 1)/200) ).append('
' + (j+1) + '
');}}if($('#AutoAnnotator_container_1381239371380 #trans_checkbox').prop('checked') == true){for ( j = 0 ; j < trans_datapoints.length ; j++ ){$('#AutoAnnotator_container_1381239371380 #hydrophobicity_charge_placeholder' + Math.floor((trans_datapoints[j][0] - 1)/200) ).append('
');}}if($('#AutoAnnotator_container_1381239371380 #sec_checkbox').prop('checked') == true){for ( j = 0 ; j < sec_helix_datapoints.length ; j++ ){$('#AutoAnnotator_container_1381239371380 #hydrophobicity_charge_placeholder' + Math.floor((sec_helix_datapoints[j][0] - 1)/200) ).append('
');}for ( j = 0 ; j < sec_strand_datapoints.length ; j++ ){$('#AutoAnnotator_container_1381239371380 #hydrophobicity_charge_placeholder' + Math.floor((sec_strand_datapoints[j][0] - 1)/200) ).append('
');}}if($('#AutoAnnotator_container_1381239371380 #acc_checkbox').prop('checked') == true){for ( j = 0 ; j < acc_buried_datapoints.length ; j++ ){$('#AutoAnnotator_container_1381239371380 #hydrophobicity_charge_placeholder' + Math.floor((acc_buried_datapoints[j][0] - 1)/200) ).append('
');}for ( j = 0 ; j < acc_exposed_datapoints.length ; j++ ){$('#AutoAnnotator_container_1381239371380 #hydrophobicity_charge_placeholder' + Math.floor((acc_exposed_datapoints[j][0] - 1)/200) ).append('
');}}}catch(err){txt='There was an error while drawing the selected elements for the plot.\n';txt=txt+'The originating error is:\n' + err + '\n\n';throw(txt);}}</script></html>

Sequence and Features


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    INCOMPATIBLE WITH RFC[21]
    Illegal BglII site found at 537
    Illegal BamHI site found at 1
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    COMPATIBLE WITH RFC[25]
  • 1000
    INCOMPATIBLE WITH RFC[1000]
    Illegal BsaI.rc site found at 924


[edit]
Categories
Parameters
None