New pages

(newest | oldest) View (newer 50 | older 50) (20 | 50 | 100 | 250 | 500)

05:02, 9 October 2022 ‎Part:BBa K4343116:Sequence, Features, and Subparts (hist) ‎[491 bytes] ‎Milulu (Talk | contribs) (Created page with " __NOTOC__ <partinfo>BBa_K4343061 short</partinfo> Derived from Y. lipoltiyca, lip2t is a terminator, a DNA sequence that terminates the transcription of RNAP. <!-- Add more...")
04:55, 9 October 2022 ‎Part:BBa K4343115:Sequence, Features, and Subparts (hist) ‎[492 bytes] ‎Milulu (Talk | contribs) (Created page with " __NOTOC__ <partinfo>BBa_K4343061 short</partinfo> Derived from Y. lipoltiyca, lip2t is a terminator, a DNA sequence that terminates the transcription of RNAP. <!-- Add mor...")
04:31, 9 October 2022 ‎Part:BBa K4343114:Sequence, Features, and Subparts (hist) ‎[508 bytes] ‎Milulu (Talk | contribs) (Created page with " __NOTOC__ <partinfo>BBa_K4343061 short</partinfo> Derived from Y. lipoltiyca, Cyc1t is a terminator a DNA sequence that terminates the transcription of RNA polymerase (RNAP)...")
12:34, 6 October 2022 ‎Part:BBa K4361000 (hist) ‎[7,380 bytes] ‎Larsvdb (Talk | contribs) (Created page with " __NOTOC__ <partinfo>BBa_K4361000 short</partinfo> Shares nucleotides of BBa_K4361001, but in a scrambled order as to no longer allow specific binding. <!-- Add more about t...")
14:00, 1 October 2022 ‎页面名称 (hist) ‎[39 bytes] ‎Flora778 (Talk | contribs) (Created page with "https://parts.igem.org/Part:BBa_K2086002")
08:45, 28 September 2022 ‎Part:Blunt (hist) ‎[6 bytes] ‎Tigress K (Talk | contribs) (Created page with "tactag")
03:44, 19 August 2022 ‎BBa K4180002 (hist) ‎[223 bytes] ‎TedChueh (Talk | contribs) (Created page with "__NOTOC__ <partinfo>BBa_K4180002 short</partinfo>")
02:34, 19 August 2022 ‎BBa K4180003 (hist) ‎[49 bytes] ‎TedChueh (Talk | contribs) (Created page with "__NOTOC__ <partinfo>BBa_K4180001 short</partinfo>")
05:33, 30 July 2022 ‎Part:BBa K4290011:Hard Information (hist) ‎[38 bytes] ‎Wqc0729 (Talk | contribs) (Created page with "CTCCGCCCATCGAATGGCCCATCACCGCGAGACGGTTG")
17:14, 12 July 2022 ‎Collections/JUMP (hist) ‎[1,258 bytes] ‎Vinoo (Talk | contribs) (Created page with "{{Catalog/MainLinks}} {{Catalog/Curation}} {{TOCright}} Joint Universal Modular Plasmids (JUMP) is a modular vector platform for Golden Gate (PhytoBrick) and Biobrick assembl...")
17:41, 5 July 2022 ‎Collections/Interlab 2022 (hist) ‎[828 bytes] ‎Vinoo (Talk | contribs) (Created page with " ===Interlab 2022 Experiment 1 Devices=== {{Template:Collection/Interlab_2022/Experiment_1/Parts}} ===Interlab 2022 Experiment 2 Devices=== {{Template:Collection/Interlab_20...")
04:16, 17 June 2022 ‎K3925013 (hist) ‎[645 bytes] ‎Lavenderxc (Talk | contribs) (Created page with "GCTCCAGCACCTGCACCTAGACCAGCTCCTCGACCACTACCAGCCCCAATTCAAGCCCCAAGACCAGCACCCGCACCACAACCTGCACCGGTTTACGCACCAGCCCCAGTCGTTTCACAAGTTCAGGCAACTTCTTCCTCTCAAGCCTCGGCTCAACAGAGTGCCTTCGCACAGT...")
03:49, 22 October 2021 ‎Part:BBa K3844004:Sequence, Features, and Subparts (hist) ‎[2,758 bytes] ‎Anya (Talk | contribs) (Created page with "==1. Function== This is another transcription factor that also binds to the Styrene VOC. It mainly regulates and represses the transcription of certain genes. ==2. Design Cons...")
03:37, 22 October 2021 ‎Part:BBa K3844003:Sequence, Features, and Subparts (hist) ‎[2,541 bytes] ‎Anya (Talk | contribs) (Created page with "==1. Function== This is a transcription factor that binds to the Styrene VOC. It mainly regulates and represses the transcription of certain genes. ==2. Design Consideration...")
03:14, 22 October 2021 ‎Part:BBa K3844002:Sequence, Features, and Subparts (hist) ‎[2,728 bytes] ‎Anya (Talk | contribs) (Created page with "==1. Function== Also known as mimR, this is a transcriptional regulator. It specializes in multiple aspects of synthetic biology, including: ATP-binding, sequence-specific DNA...")
02:10, 22 October 2021 ‎Part:BBa K3844001:Sequence, Features, and Subparts (hist) ‎[2,445 bytes] ‎Anya (Talk | contribs) (Created page with "==1. Function== Our project requires for the transcription factor to be dependent on the presence of VOCs. When researching the design of trimethylbenzene, the VOC that this t...")
23:11, 21 October 2021 ‎Part:BBa K942020 (hist) ‎[462 bytes] ‎Jana1907 (Talk | contribs) (Created page with "<partinfo>BBa_K3782005 short</partinfo> This part has been further characterized by the 2021 iGEM UNILausanne team. The sequence has been codon optimized for E. coli</...")
22:56, 21 October 2021 ‎T--NPU-CHINA--img084.png (hist) ‎[62 bytes] ‎HHDDSteve (Talk | contribs) (Created page with "https://2021.igem.org/wiki/images/8/8a/T--NPU-CHINA--img84.png")
15:15, 21 October 2021 ‎T--Tsinghua--LAP plasmid.png (hist) ‎[0 bytes] ‎Gooolf (Talk | contribs) (Created page with "https://parts.igem.org/File:T--Tsinghua--LAP_plasmid.png")
18:01, 19 October 2021 ‎Arthrospira platensis (hist) ‎[0 bytes] ‎Vinoo (Talk | contribs) (Created blank page)
11:10, 19 October 2021 ‎Part:BBa K3941006 (hist) ‎[1,440 bytes] ‎Boraciner (Talk | contribs) (Created page with " __NOTOC__ <partinfo>BBa_K3941005 short</partinfo> BBa_K3941005 is a composite part that we used in our expression plasmids (pET29b). We obtain EG2 wild type with this sequen...")
22:36, 18 October 2021 ‎Part:BBa K4074035:Hard Information (hist) ‎[362 bytes] ‎Alpusey (Talk | contribs) (Created page with "Contents: Pveg - rbs - mlsR - T004 What it is: Pveg is a constitutive promoter. An rbs, or ribosome binding site, is a sequence of nucleotides upstream of the start codon of a...")
22:30, 18 October 2021 ‎Part:BBa K4074036:Hard Information (hist) ‎[636 bytes] ‎Alpusey (Talk | contribs) (Created page with "Contents: lox71, bkd promoter, Pveg, lox66 What it is: Lox71 is a site specific recombination cassette and belongs to the loxP family. Pveg is a constitutive promoter. What it...")
21:15, 17 October 2021 ‎Part:BBa K4074015:Hard Information (hist) ‎[124 bytes] ‎Alpusey (Talk | contribs) (Created page with "Contents: tetR What it is: transcriptional repressor What it does: prevents the expression of certain genes at the DNA level")
21:05, 17 October 2021 ‎Part:BBa K4074013:Hard Information (hist) ‎[120 bytes] ‎Alpusey (Talk | contribs) (Created page with "Contents: mtag bfp What is it: a basic (constitutively fluorescent) blue fluorescent protein What it does: tags proteins")
21:00, 17 October 2021 ‎Part:BBa K4074012:Hard Information (hist) ‎[131 bytes] ‎Alpusey (Talk | contribs) (Created page with "Contents: bkdB What is it: component of pyruvate dehydrogenase complex What it does: transferase activity, transferring acyl groups")
17:02, 17 October 2021 ‎3735010 (hist) ‎[392 bytes] ‎YihengYang (Talk | contribs) (Created page with "In order to improve the quality of SeNPs and improve the reduction efficiency, we hope to link those standard parts and then, two genes express at the same time. This part con...")
19:49, 15 October 2021 ‎Collections/CRISPR-Cas for Diagnosis (hist) ‎[29,086 bytes] ‎Vinoo (Talk | contribs) (Created page with "{{Catalog/MainLinks}} {{TOCright}} {{Catalog/Curation/User_Collection}}")
07:36, 10 October 2021 ‎Part:BBa K3779027:Related Parts (hist) ‎[103 bytes] ‎JunfengHui (Talk | contribs) (Created page with "BBa_K3779000 BBa_K3779002 BBa_K3779001 BBa_K3779003 BBa_K3779006 BBa_K3779007 BBa_K3779020 BBa_K3779008")
11:32, 7 October 2021 ‎Creating Part:BBa K3904228:Hard Information (hist) ‎[69 bytes] ‎Rimvyde318 (Talk | contribs) (Created page with "TAGTATTTTTCGGTCATTTTAACTTGCTATTTCTTGAAGAGGTTAGTACAATATGAATCGTGGTAAGTA")
13:59, 6 October 2021 ‎Part:BBa K3196099:Sequence, Features, and Subparts (hist) ‎[267 bytes] ‎JunfengHui (Talk | contribs) (Created page with "atgagatttccttcaatttttactgcagttttattcgcagcatcctccgcattagctgctccagtcaacactacaacagaagatgaaacggcacaaattccggctgaagctgtcatcggttactcagatttagaaggggatttcgatgttgctgttttgccattttccaacagca...")
13:21, 6 October 2021 ‎Part:BBa K3196099:Hard Information (hist) ‎[0 bytes] ‎JunfengHui (Talk | contribs) (Created page with "Structure and function of A-factor signal peptide At present, the most widely used and most successful signal peptide in Pichia pastoris system is saccharomyces cerevisiae...")
17:52, 4 October 2021 ‎Part:BBa K4047000:Hard Information (hist) ‎[702 bytes] ‎Anniequyan (Talk | contribs) (Created page with "This is the forward primer for transaldolase. The overlap sequence (acacaggaaacagaccatgg) allows proper Gibson assembly with the pGEM-tal backbone. The intermediate aattc sequ...")
05:18, 1 October 2021 ‎(3) (hist) ‎[190 bytes] ‎NancyZhu (Talk | contribs) (Created page with "Nakajima M, Ferri S, Rögner M, Sode K. Construction of a Miniaturized Chromatic Acclimation Sensor from Cyanobacteria with Reversed Response to a Light Signal. Sci Rep. 2016...")
05:17, 1 October 2021 ‎(2) (hist) ‎[224 bytes] ‎NancyZhu (Talk | contribs) (Created page with "Hirose Y, Shimada T, Narikawa R, Katayama M, Ikeuchi M. Cyanobacteriochrome CcaS is the green light receptor that induces the expression of phycobilisome linker protein. Proc...")
05:15, 1 October 2021 ‎(1) (hist) ‎[168 bytes] ‎NancyZhu (Talk | contribs) (Created page with "Schmidl SR, Sheth RU, Wu A, Tabor JJ. Refactoring and optimization of light-switchable Escherichia coli two-component systems. ACS Synth Biol. 2014 Nov 21;3(11):820-31.")
06:25, 19 September 2021 ‎Part:BBa K3853000:Recent Changes (hist) ‎[4 bytes] ‎Lp-tiffany (Talk | contribs) (→‎Biology)
19:28, 28 March 2021 ‎Collections/Functional Nucleic Acids/Aptamers (hist) ‎[3,194 bytes] ‎AptamersBoi (Talk | contribs) (Created page with "Aptamers: molecule recognition elements Aptamers are short nucleic-acid motifs that display recognition and binding properties for spec...")
14:39, 28 March 2021 ‎Collections/Functional Nucleic Acids/Aptazymes (hist) ‎[3,565 bytes] ‎AptamersBoi (Talk | contribs) (Created page with "Aptazymes: modularly engineered nucleic acid enzymes Aptazymes are ligand-dependent self-cleaving ribozymes (J. Tang & Breaker, 1997)....")
14:27, 28 March 2021 ‎Collections/Functional Nucleic Acids/Riboswitches (hist) ‎[6,609 bytes] ‎AptamersBoi (Talk | contribs) (Created page with "Riboswitches: gene expression regulating devices Riboswitches are regulatory domains present in messenger RNA (mRNA) molecules that ca...")
14:20, 28 March 2021 ‎Collections/Functional Nucleic Acids/Ribozymes (hist) ‎[9,310 bytes] ‎AptamersBoi (Talk | contribs) (Created page with "Ribozymes: RNA catalysts mimic enzymes RNA was discovered to possess catalytic activity in the early 1980s, when self-splicing introns...")
13:49, 28 March 2021 ‎Collections/Functional Nucleic Acids/DNAzymes (hist) ‎[3,622 bytes] ‎AptamersBoi (Talk | contribs) (Created page with "DNAzymes: Enzyme-mimicking DNA architectures Deoxyribozymes, so-called “DNAzymes”, are functional single-stranded DNA molecules ex...")
14:28, 10 March 2021 ‎Collections/Aptamers (hist) ‎[34 bytes] ‎Vinoo (Talk | contribs) (Created page with "{{Catalog/MainLinks}} {{TOCright}}")
19:26, 27 October 2020 ‎K3600010 (hist) ‎[314 bytes] ‎Yasmine koubaa (Talk | contribs) (Created page with " __NOTOC__ <partinfo>BBa_K3600010 short</partinfo> ===Usage and Biology===  Sequence and Features <partinfo>BBa_K3600010 SequenceAndFe...")
17:19, 27 October 2020 ‎Part:BBa C0012:Hard Information (hist) ‎[961 bytes] ‎Fz903 (Talk | contribs) (Created page with " =BHSF 2020's characterization= After we decided to use toggle switch as the principle of our circuit, and use lac as a molecule in our circuit, we used these keywo...")
04:42, 26 October 2020 ‎Part:BBa K35620013:Design (hist) ‎[308 bytes] ‎MAOLIRAN (Talk | contribs) (Created page with " __NOTOC__ <partinfo>BBa_K3562013 short</partinfo> <partinfo>BBa_K3562013 SequenceAndFeatures</partinfo> ===Design Notes=== This sequence is reserve translated from protei...")
10:21, 25 October 2020 ‎Part:BBa K1316002: Specified Uses In Other Parts (hist) ‎[356 bytes] ‎Hao-Xu (Talk | contribs) (Created page with "yqjF (BBa_K1316002) The iGEM20 NEFU_China uses optical biosensors in the Bio-optical Landmine Detection, with the yqjF promoter as the core component. The yqjF promoter has be...")
14:22, 22 October 2020 ‎Collections/Immune Regulation (hist) ‎[2,122 bytes] ‎Vinoo (Talk | contribs) (Created page with "{{Catalog/MainLinks}} {{TOCright}}")
16:14, 21 October 2020 ‎DNA Submission Batches (hist) ‎[7,455 bytes] ‎Linruixin (Talk | contribs) (Created page with "<!DOCTYPE html> <html> <head> <meta charset="utf-8" /> <title></title> <link rel="stylesheet" href="https://cdn.staticfile.org/twitter-bootstrap/3.3.7/css/bootstrap.min...")
15:06, 21 October 2020 ‎BBA K 3506021 (hist) ‎[0 bytes] ‎Chenyiling (Talk | contribs) (Created blank page)

(newest | oldest) View (newer 50 | older 50) (20 | 50 | 100 | 250 | 500)

Namespace:	Invert selection
Username:

	Hide registered users \| Hide bots \| Show redirects