User contributions
(newest | oldest) View (newer 50 | older 50) (20 | 50 | 100 | 250 | 500)
- 06:49, 20 October 2021 (diff | hist) . . (-277) . . Part:BBa K392001 (current)
- 06:49, 20 October 2021 (diff | hist) . . (+278) . . Part:BBa K392001
- 06:47, 20 October 2021 (diff | hist) . . (+2,232) . . Part:BBa K3779018 (current)
- 06:46, 20 October 2021 (diff | hist) . . (+2,055) . . Part:BBa K3779009 (current)
- 06:45, 20 October 2021 (diff | hist) . . (+128) . . Part:BBa K3196099 (current)
- 06:36, 20 October 2021 (diff | hist) . . (+21) . . Part:BBa K3196099
- 06:32, 20 October 2021 (diff | hist) . . (+1) . . Part:BBa K392001
- 06:30, 20 October 2021 (diff | hist) . . (+2,209) . . Part:BBa K392001
- 05:55, 16 October 2021 (diff | hist) . . (+1) . . Part:BBa K3196099:Design (→References) (current)
- 05:47, 16 October 2021 (diff | hist) . . (+268) . . Part:BBa K392001:Design (→References) (current)
- 05:47, 16 October 2021 (diff | hist) . . (-280) . . Part:BBa K392001:Experience (→Applications of BBa_K392001) (current)
- 05:45, 16 October 2021 (diff | hist) . . (-20) . . Part:BBa K392001:Experience (→Applications of BBa_K392001)
- 05:41, 16 October 2021 (diff | hist) . . (+1) . . Part:BBa K392001:Experience (→Applications of BBa_K392001)
- 05:36, 16 October 2021 (diff | hist) . . (+2,510) . . Part:BBa K392001:Experience (→Applications of BBa_K392001)
- 06:23, 13 October 2021 (diff | hist) . . (-33) . . Part:BBa K3779009:Experience (→Applications of BBa_K3779009) (current)
- 06:19, 13 October 2021 (diff | hist) . . (-17) . . Part:BBa K3779018:Experience (→Applications of BBa_K3779018) (current)
- 12:53, 10 October 2021 (diff | hist) . . (-22) . . Part:BBa K3196099:Experience (→Applications of BBa_K3196099) (current)
- 12:34, 10 October 2021 (diff | hist) . . (+22) . . Part:BBa K3196099:Experience
- 12:32, 10 October 2021 (diff | hist) . . (+123) . . Part:BBa K3196099:Design (→References)
- 12:29, 10 October 2021 (diff | hist) . . (-6) . . Part:BBa K3196099:Experience (→Applications of BBa_K3196099)
- 10:36, 10 October 2021 (diff | hist) . . (+1,848) . . Part:BBa K3196099:Experience (→Applications of BBa_K3196099)
- 07:36, 10 October 2021 (diff | hist) . . (+103) . . N Part:BBa K3779027:Related Parts (Created page with "BBa_K3779000 BBa_K3779002 BBa_K3779001 BBa_K3779003 BBa_K3779006 BBa_K3779007 BBa_K3779020 BBa_K3779008") (current)
- 15:35, 6 October 2021 (diff | hist) . . (0) . . File:Eno1.png (JunfengHui uploaded a new version of File:Eno1.png) (current)
- 15:34, 6 October 2021 (diff | hist) . . (0) . . File:Eno1.png (JunfengHui uploaded a new version of File:Eno1.png)
- 15:33, 6 October 2021 (diff | hist) . . (0) . . File:Eno1.png (JunfengHui uploaded a new version of File:Eno1.png)
- 15:30, 6 October 2021 (diff | hist) . . (0) . . N File:Eno1.png
- 14:18, 6 October 2021 (diff | hist) . . (0) . . File:SWTX202006026 01500.jpg (JunfengHui uploaded a new version of File:SWTX202006026 01500.jpg) (current)
- 14:03, 6 October 2021 (diff | hist) . . (0) . . N File:SWTX202006026 01500.jpg
- 14:00, 6 October 2021 (diff | hist) . . (+124) . . Part:BBa K3196099:Design (→References)
- 13:59, 6 October 2021 (diff | hist) . . (+267) . . N Part:BBa K3196099:Sequence, Features, and Subparts (Created page with "atgagatttccttcaatttttactgcagttttattcgcagcatcctccgcattagctgctccagtcaacactacaacagaagatgaaacggcacaaattccggctgaagctgtcatcggttactcagatttagaaggggatttcgatgttgctgttttgccattttccaacagca...") (current)
- 13:22, 6 October 2021 (diff | hist) . . (-2,535) . . m Part:BBa K3196099:Hard Information (Blanked the page) (current)
- 13:21, 6 October 2021 (diff | hist) . . (+2,535) . . N Part:BBa K3196099:Hard Information (Created page with "Structure and function of A-factor signal peptide At present, the most widely used and most successful signal peptide in Pichia pastoris system is saccharomyces cerevisiae...")
- 13:13, 6 October 2021 (diff | hist) . . (+2,474) . . Part:BBa K3196099
- 14:55, 5 October 2021 (diff | hist) . . (-128) . . Part:BBa K3196099:Design (→References)
- 14:55, 5 October 2021 (diff | hist) . . (-2,524) . . Part:BBa K3196099:Design (→Design Notes)
- 14:47, 5 October 2021 (diff | hist) . . (+128) . . Part:BBa K3196099:Design (→References)
- 14:45, 5 October 2021 (diff | hist) . . (+2,522) . . Part:BBa K3196099:Design (→Design Notes)
- 17:52, 27 September 2021 (diff | hist) . . (+41) . . Part:BBa K3779004:Design (→Design Notes) (current)
- 17:48, 27 September 2021 (diff | hist) . . (+426) . . Part:BBa K3779004:Design (→Design Notes)
- 17:30, 27 September 2021 (diff | hist) . . (+50) . . Part:BBa K3779004:Design (→Design Notes)
- 03:11, 28 October 2020 (diff | hist) . . (+18) . . Part:BBa K3052002 (current)
- 03:02, 28 October 2020 (diff | hist) . . (+150) . . Part:BBa K3388015 (current)
- 03:00, 28 October 2020 (diff | hist) . . (+1,126) . . Part:BBa K3052002
- 02:58, 28 October 2020 (diff | hist) . . (+3,975) . . Part:BBa K3388015
- 02:58, 28 October 2020 (diff | hist) . . (+78) . . Part:BBa K3388014 (current)
- 02:52, 28 October 2020 (diff | hist) . . (0) . . N File:T--NWU-CHINA-B--sepuyangpin.jpg (current)
- 02:52, 28 October 2020 (diff | hist) . . (+2,038) . . Part:BBa K3388014
- 02:50, 28 October 2020 (diff | hist) . . (0) . . N File:T--NWU-CHINA-B--sepubiao.jpg (current)
- 02:44, 28 October 2020 (diff | hist) . . (0) . . N File:T--NWU-CHINA-B--dianyong.jpg (current)
- 02:42, 28 October 2020 (diff | hist) . . (0) . . File:T--NWU-CHINA-B--ningjiao.jpg (JunfengHui uploaded a new version of File:T--NWU-CHINA-B--ningjiao.jpg) (current)
(newest | oldest) View (newer 50 | older 50) (20 | 50 | 100 | 250 | 500)