Part:BBa_K4197001
OmpA_DARPin fusion + mTagBFP
Gene fusion to express the DARPin protein on the surface of blue fluorescent E. coli.
Introduction
This part is composed of the gene coding for the DARPin E2_79 protein. This synthetic protein has a strong affinity for the constant part of IgE (Baumann et al., 2010). It was merged to the membrane protein OmpA of E. coli
(BBa_K1694002) to display the DARPin on the surface of E. coli . This lipoprotein is the most abundant in E. coli's membrane with 100,000 copies per cell (Ortiz-Suarez and al. 2016) and is often used to display protein on the
surface of bacteria (Yang and al. 2016). The fusion protein is described in Part: BBa_K4197011.
This part is also composed of the gene coding for the mTagBFP (BBa_K592100), a bright blue fluorescent protein. It also contains the gene coding for the 800 first bp of the
ihfB promoter, which was used to express mTagBFP. This promoter has been identified as a constitutive E. coli promoter (Weglenska et al., 1996). It is often used by researchers of the Toulouse Biotechnology Institute to
express recombinant fluorescent proteins in E. coli (Barthe et al., 2020), as it is strong enough to allow correct expression and weak enough to avoid inclusion bodies.
Construction
The fusion protein OmpA_DARPin was expressed in the pET-21 b (+) plasmid. As explained in Part BBa_K4197011, two versions of the fusion protein were built, as the first one
presented a missing DNA fragment (more details in the corresponding part).
The pET-21 b (+)_OmpA_DARPin obtained (first version) was linearized by PCR using the primers FORWARD:gccgagatcgctaccgctctgaaaatacaggttttcactg and REVERSE:ctgcatcttgcagccatgctaggccatctggaaattg.
Amplification product sizes were checked on EtBr stained agarose gel. Expected size was 6317 bp. Figure 1 shows amplicon matching expected size.
The ihfb800-mTagBFP construction provided by Manon Barthe (researcher at Toulouse Biotechnology Institute) was amplified by PCR with a high-fidelity Phusion polymerase using primers FORWARD: cgcgggatcgagatctatcacgaggcagaatttcagat and REVERSE: tagaggatcgagatctctgaaacagtgcaaagctaaccc. Amplification product sizes were checked on EtBr stained agarose gel. The expected size of the amplicon was 1595 bp. Figure 2 shows ammplicon matching expected size.
The linearized pET-21 b (+)_OmpA_DARPin plasmid and the ihfb800-BFP fragment were extracted from gel and purified with the PCR clean-up protocol, then assembled by In-Fusion. The product was transformed in Stellar cells and transformants were selected on Ampicillin. Plasmids from the resulting colonies were extracted by Miniprep. The presence of BFP was assessed by PCR screening with primers FORWARD: ggttatgctagttattgctcagc and REVERSE: ccgaaacaagcgctcatgagc. Amplification product sizes were checked on EtBr stained agarose gel. The expected size of the amplicon was 2892 bp. Figure 3 shows amplicon matching expected size.
Finally, the pET-21 b (+)_OmpA_DARPin_mTagBFP plasmid was used to transform E. coli Tuner (DE3) cells. An overnight preculture of the transformed cells was performed to control the blue fluorescence on a microscope (Figure 4). A colony containing the pET-21 b (+)_OmpA_DARPin without ihfb800-BFP was used as a negative control. The microscope parameters to observe BFP were the following: excitation filter 360/40, dichroic beamsplitter 400 nm, emission filter 470/40.
The sample was considerably more fluorescent than the negative control, indicating a correct expression of the mTagBFP.
The pET-21 b (+)_OmpA_DARPin_mTagBFP plasmid was then linearized and assembled with the missing DARPin* fragment by In-Fusion. The product was transformed in Stellar cells and transformants were selected on Ampicillin. Plasmids from the resulting colonies were extracted by Miniprep. The presence of BFP was assessed by PCR screening with primers FORWARD: tggtgatgcagtttctgcaaaatttccgcc and REVERSE: ggtagcgatctcggcaagaaattac. Amplification product sizes were checked on EtBr stained agarose gel. The expected size of the amplicon was 384 bp. Figure 5 shows amplicon matching expected size.
Plasmid from positive transformants were extracted by Miniprep and digested to assess the assembly (data not shown). Sequences were validated by sequencing, thus completing the pET-21 b (+)_OmpA_DARPin*_BFP construction.
The plasmids were finally used to transform E. coli Tuner cells to express the pET-21 b (+)_OmpA_DARPin_BFP correct construction at the cell membrane. This construction was used by the iGEM Toulouse 2022 team in a Fluorescence-Activated Cell Sorting (FACS) platform. The FACS successfully isolated the cells expressing OmpA_DARPin_BFP (data not shown).
References
More information about the project for which the part was created: DAISY (INSA-UPS 2022)
Other parts of OmpA fusion proteins associated with an ihfB800-induced fluorescent protein:
- OmpA_Ara h 2_mScarlet-I
- OmpA_Ana o 3_mScarlet-I
- Baumann, M. J., Eggel, A., Amstutz, P., Stadler, B. M., & Vogel, M. (2010). DARPins against a functional IgE epitope. Immunology Letters, 133(2), 78–84. https://doi.org/10.1016/j.imlet.2010.07.005
- Ortiz-Suarez, M. L., Samsudin, F., Piggot, T. J., Bond, P. J., & Khalid, S. (2016). Full-Length OmpA : Structure, Function, and Membrane Interactions Predicted by Molecular Dynamics Simulations. Biophysical Journal, 111(8), 1692–1702. https://doi.org/10.1016/j.bpj.2016.09.009
- Yang, Chao; Zhao, Qiao; Liu, Zheng; Li, Qiyun; Qiao, Chuanling; Mulchandani, Ashok; et al. (2016): Cell Surface Display of Functional Macromolecule Fusions on Escherichia coli for Development of an Autofluorescent Whole-Cell Biocatalyst. ACS Publications. Journal contribution. https://doi.org/10.1021/es800441t.s001
- Wȩgleńska, A., Jacob, B., & Sirko, A. (1996). Transcriptional pattern of Escherichia coli ihfB (himD) gene expression. Gene, 181(1-2), 85–88. https://doi.org/10.1016/s0378-1119(96)00468-4
- Barthe, M., Tchouanti, J., Gomes, P. H., Bideaux, C., Lestrade, D., Graham, C., Steyer, J.-P., Meleard, S., Harmand, J., Gorret, N., Cocaign-Bousquet, M., & Enjalbert, B. (2020). Availability of the Molecular Switch XylR Controls Phenotypic Heterogeneity and Lag Duration during Escherichia coli Adaptation from Glucose to Xylose. mBio, 11(6), Article e02938-20. https://doi.org/10.1128/mbio.02938-20
Sequence and Features
- 10INCOMPATIBLE WITH RFC[10]Illegal EcoRI site found at 1526
Illegal EcoRI site found at 1740
Illegal XbaI site found at 1511
Illegal XbaI site found at 1657
Illegal PstI site found at 213
Illegal PstI site found at 224
Illegal PstI site found at 342 - 12INCOMPATIBLE WITH RFC[12]Illegal EcoRI site found at 1526
Illegal EcoRI site found at 1740
Illegal NheI site found at 1702
Illegal PstI site found at 213
Illegal PstI site found at 224
Illegal PstI site found at 342
Illegal NotI site found at 1518
Illegal NotI site found at 2510 - 21INCOMPATIBLE WITH RFC[21]Illegal EcoRI site found at 1526
Illegal EcoRI site found at 1740
Illegal BglII site found at 1591
Illegal BamHI site found at 1734
Illegal XhoI site found at 2519 - 23INCOMPATIBLE WITH RFC[23]Illegal EcoRI site found at 1526
Illegal EcoRI site found at 1740
Illegal XbaI site found at 1511
Illegal XbaI site found at 1657
Illegal PstI site found at 213
Illegal PstI site found at 224
Illegal PstI site found at 342 - 25INCOMPATIBLE WITH RFC[25]Illegal EcoRI site found at 1526
Illegal EcoRI site found at 1740
Illegal XbaI site found at 1511
Illegal XbaI site found at 1657
Illegal PstI site found at 213
Illegal PstI site found at 224
Illegal PstI site found at 342
Illegal AgeI site found at 329
Illegal AgeI site found at 2307 - 1000COMPATIBLE WITH RFC[1000]
None |