Part:BBa_K5317022

3xCre3xAP1-miniCMV-miRFP670

Usage and Biology

When ß-lactams bind to the PASTA domain of PknB, its kinase domain phosphorylates ATF2, which then binds to our promoter. The promoter was identified by (Miller et al., 2010) as cyclic AMP responsive element (Cre)-sequence. ATF2-binding site is a consensus: 5-GTGACGT[AC][AG]-3) cAMP response element (CRE) (Hai et al., 1989). Based on observations made by Miller and colleagues (2010) showing similar kinase mechanisms between the prokaryotic PknB and eukaryotic MAPK towards ATF2, we generated a synthetic ATF2-responsive promoter construct with three Cre and three AP1 binding sites as well as a miniCMV promoter sequence. ATF2 was identified as the best PknB interaction partner. As with all our constructs, our promoter is followed by a fluorescent marker gene miRFP670 to detect specific activation

Cloning

Theoretical Part Design

We placed the miRFP670 fluorescent marker (K5317002) downstream behind this synthetic promotor (K5317017).

Sequence and Features

Assembly Compatibility:

• 10
  INCOMPATIBLE WITH RFC[10]

  Illegal PstI site found at 1132
  
• 12
  INCOMPATIBLE WITH RFC[12]

  Illegal PstI site found at 1132
  
• 21
  INCOMPATIBLE WITH RFC[21]

  Illegal BamHI site found at 788
  
• 23
  INCOMPATIBLE WITH RFC[23]

  Illegal PstI site found at 1132
  
• 25
  INCOMPATIBLE WITH RFC[25]

  Illegal PstI site found at 1132
  Illegal NgoMIV site found at 451
  Illegal NgoMIV site found at 739
  Illegal NgoMIV site found at 774
  
• 1000
  COMPATIBLE WITH RFC[1000]

Cloning

This plasmid was engineered with NEBBuilder HIFI assembly method. First the backbone eGFP-C2neo was lineraized with AseI and BamHI, creating matching overhangs to the synthesized ATF2-3xCre3xAP1-Promoter_miniCMV sequence and the miRFP670 gene in the backbone ensured seamless cloning with predetermined order. We have designed this sequence containing triplicates of the Cre binding site as well as the AP1 binding site to increase the signal intensity. To ensure an optimal gene expression of miRFP670 we clonded behind the recognition sequenz of ATF1 a mini-CMV-Promotor. The promoter insert was synthesized with the correct overhangs already. The miRFP670 reporter gene was amplifyied by PCR using the primers in table 1.

Table 1: Primers used to amplify miRFP670 with matching 3' and 5' overhangs.

Primer name	Sequence
miRFP670_fw	tgccaccatggtagcaggtcatgc
miRFP670_rv	TCAGTTATCTAGATCCGGTGtcagctctcaagcgcggtga

Figure 1: Assembled vector map with ATF2-3xCre3xAP1-Promoter_miniCMV_miRFP670 integrated into the pEGFP-C2 backbone.

Characterisation

Transfection experiments in mammalian HEK293T cells assessed the promoter functionality, sensitivity and specifity. The composite part carrying plasmid was introduced via transfection to establish a baseline of endogenous promoter activity before performing co-transfection experiments with the CMV-ATF2-EGFP (composite part K5317016) and CMV-PknB-mRuby2 carrying plasmid (composite part K5317013) for ampicillin stimulation. The EGFP, mRuby and miRFP650 fluorescence signal was analyzed for localization by microscopy and intensity by FACS analysis.

Single-transfection experiments

Figure 2: Microscopic image of depicted HEK cells expressing ATF2-3xCre3xAP1-Promoter_miniCMV_miRFP670. Shown are fluorescence channel for eGFP, mRuby and miRFP670.

In Figure 2 are transfected HEK cells shown, transfected with ATF2-3xCre3xAP1-Promoter_miniCMV_miRFP670. To show basal promotor activity ATF2-3xCre3xAP1-Promoter_miniCMV_miRFP670 was stimulated with and without 100 µg/mL Ampicillin.

Triple-transfection experiments

Figure 3: Representative microscopy image of HEK cells expressing EGFP-PknB, ATF2-mRuby2 and ATF2-3xCre3xAP1-Promoter_miniCMV_miRFP670. Shown are the fluorescence channels for eGFP, mRuby2 and miRFP670 (first three images from the left) and an overlay of the three channels (right). In a) is shown the basal activity of the promoter. In b) is shown the promoter activity after induction with 100 µg/mL ampicillin after four hours of incubation.

In Figure 3 are HEK cells co-transfected with our composite parts EGFP-PknB and ATF2-mRuby2 as well as our tested promoter-driven reporter depicted. ATF2 expression is shown in red and the respective reporter miRFP670 expression, which indicated a basal promoter activity, in pink. Particularly noteworthy here is the correct localization of the prokaryotic membrane protein PknB in the eukaryotic cell membrane, in green.

FACS Analysis

Figure 4: Quantitive validation of reporter activity by flow cytometry analysis. The percentage of cells expressing the fluorophore under the control of the tested ATF2-3xCre3xAP1-Promoter is displayed as a function of various concentrations of ampicillin.

The results in Figure 4 are presented in the bar chart displayed in figure 10. Here, the percentage of cells expressing the fluorophore under the control of the tested ATF2-3xCre3xAP1-Promoter is displayed as a function of various concentrations of ampicillin.

References

Hai, T. W., Liu, F., Coukos, W. J., & Green, M. R. (1989). Transcription factor ATF cDNA clones: An extensive family of leucine zipper proteins able to selectively form DNA-binding heterodimers. Genes & Development, 3(12b), 2083–2090. https://doi.org/10.1101/gad.3.12b.2083

Miller, M., Donat, S., Rakette, S., Stehle, T., Kouwen, T. R. H. M., Diks, S. H., Dreisbach, A., Reilman, E., Gronau, K., Becher, D., Peppelenbosch, M. P., Van Dijl, J. M., & Ohlsen, K. (2010). Staphylococcal PknB as the First Prokaryotic Representative of the Proline-Directed Kinases. PLoS ONE, 5(2), e9057. https://doi.org/10.1371/journal.pone.0009057