Composite

Part:BBa_K5107008

Designed by: Georgios Retsinias   Group: iGEM24_DTU-Denmark   (2024-09-22)
Revision as of 17:20, 30 September 2024 by Georgiosr (Talk | contribs) (For the rest of the characterisations, check BBa_K5107007)


T7-EREmin-sB-T

T7-EREminimal-sB-T is a construct used by the cell free biosensor.The EREmininimal is recognised by the steroid estrogen hormone receptor. Then in vitro transcription of the momomeric broccoli is taken place if the hormone is present or not in the cell free solution.

Usage and Biology

For the structure of the biosensor, we took inspiration from the ROSALIND cell-free biosensor[1], modifying their design to match our goals. We kept the general idea of having a Transcription Factor (TF) altering the activity of a RNA polymerase, and the output signal as a consequence. We tailored the ROSALIND concept by selecting specific custom transcription factors (TFs) as receptors and designing unique operator sequences to serve as responsive elements.

Cell free biosensor

This is the principal function of our desinged biosensor

Cell-Free System Part 1
Figure 2: Cell-Free System - No Hormone/EDC in the environment.
Cell-Free System Part 2
Figure 3: Cell-Free System - Hormone/EDC in the environment.
When no EDC is present(Figure 2), the receptor will not bind the DNA, and thus the T7 RNAP is free to interact with the promoter, and transcribe the Broccoli aptamer. Once produced, the aptamer binds to the DFHBI-1T fluorophore, and enables fluorescence, by absorbing light at 472 nm and emitting it at 507 nm. When an EDC is present(Figure 3), it will bind the hormone receptor and induce a conformational change that will allow it to bind the receptor response element. Once the receptor is bound to the DNA, it will act as a repressor, suppressing the transcription from the T7 RNA promoter.

Assemply

Human Receptor Information
Human Receptor Response Element (Operator Site) Natural Hormone Plasmid Name (In-Cell System)
Estrogen Receptor α (ERα) ERE 17β-Estradiol pRR-ERalpha-5Z
Estrogen Receptor β (ERβ) ERE 17β-Estradiol pRR-ERbeta-5Z
Glucocorticoid Receptor (GR) HRE Dexamethasone pRR-GR-5Z
Androgen Receptor (AR) HRE Testosterone pRR-AR-5Z
Mineralocorticoid Receptor (MR) HRE Aldosterone pRR-MR-5Z
Progesterone Receptor (PR) HRE Progesterone pRR-PR-5Z

Table 1: Human Receptor Information


We designed DNA templates using two response elements: ERE and HRE, designed to interact with the above-listed receptors (see Table 1 for details). We designed versions with only a single response element and only a single repeat. For its minimalistic approach, we denoted these parts EREminimal:BBa_K5107001 and HREminimal:BBa_K5107000. The sequence for these parts can be seen below:

Minimal Response Elements
Element Sequence
EREminimal CCAGGTCAGAGTGACCTG
HREminimal AGAACAGAGTGTTCT

Table 2: Minimal Response Elements


  • Design - Generating a measurable readout

As for the output, we decided to go for a less tedious reporter than the one previously used. For our cell-free system, the simplest and fastest way to have an output is to use an aptamer, and we opted for the fluorescent broccoli aptamer, which, when bound to the fluorophore DFHBI-1T, will produce green fluorescence upon excitation. We design the single broccoli aptamer (abbreviated “sB”) surrounded by two tRNA scaffolds to increase its stability (inspired from what other igem teams have noticed(iGEM20_Edinburgh)) in combination with the HREminimal and EREminimal responsive elements. The reason for this choice is that we discovered a synthesis limitation during a preliminary check on our sponsor IDT's website.

The ready-to-be-synthesized DNA templates named T7-HREminimal-sB-T and T7-EREminimal-sB-T are shown in the image below:

Figure 1:Overview of the T7-HREminimal-sB-T and T7-EREminimal-sB-T DNA fragments used for the cell-free system. T7 promoter, response elements, aptamer parts and terminators are shown. Not to scale.


Primers for IVT Template
Forward Primer Reverse Primer
IVT Template gcggataacaatttcacacaggaaacagc caaaaaacccctcaagacccg

Table 2: Primer for IVT template amplification

  • Validation

As we mentioned above, the construct is ready-to-be-synthesized, that means it is delivered to us by IDT as a G-block. Then using appropiate primers(Table 2) we amplify and purify the IVT template used in our biosensor. Here it is shown only the gel electrophoresis of the T7-HREminimal-sB-T.

PCR validation of the ROSALIND templates
Figure 4: PCR validation of the cell free biosensor template(T7-HREminimal-sB-T).

Test and Optimization

To test the created parts, we performed two iterations. Firstly, we tested and optimized the fluorescence output without the presence of any receptor or ligand (Test & Learn I), to ensure that the design at its basic level works properly. Secondly, we proceeded by testing the biosensor on its whole with the receptor and the ligands (Test & Learn II).

1. Wavelength and Plate reader setting

  • Rationale: As the signal for the first experiments was erratic and sometimes incoherent, we tried to improve the reading settings.
  • Result:Higher fluorescence output was yielded by:
Using the wavelength couple 488/530 nm. 
Reading from the top (instead from the bottom)

Figure 5: Wavelength optimization.Fluorescein sodium salt was used as reference.
2. Buffer test

  • Rationale: Optimize the reaction to increase the signal

Initially, for the first transcription test, we used a custom In Vitro Transcription (IVT) buffer recommended from the ROSALIND protocol (where we took the inspiration for the cell-free system). However, we didn’t get any fluorescence emission by using that custom buffer.

  • Result: The commercial In Vitro Transcription (IVT) buffer was better than the custom made.

When using the commercial buffer, we could see a much higher output signal. The custom buffer clearly is not ideal for the cell-free transcription, while the commercial buffer seems to work much better. A possible explanation for this, is the ionic concentration, which is much higher in the custom buffer (especially NaCl). Either the indicated concentrations were wrong (we in fact acknowledge a mistake in the ROSALIND protocol, as the indicated concentration of the NaCl ion was too high) or we made a mistake in the process of preparing it.

For the rest of the characterisations, check BBa_K5107007

Sequence and Features


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    COMPATIBLE WITH RFC[21]
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    COMPATIBLE WITH RFC[25]
  • 1000
    COMPATIBLE WITH RFC[1000]



References

  1. Chen, R., Cheng, H., Jin, P., Song, L., Yue, T., Hull, M., & Mansell, T. J. (2020). Nature Biotechnology, 38(10), 1107–1112. https://doi.org/10.1038/s41587-020-0571-7

[edit]
Categories
Parameters
None